.DELTA.6 acetylenase and .DELTA.6-desaturase from ceratodon purpureus

The present invention relates to a process for preparing unsaturated fatty acids and to a process for preparing triglycerides with an increased content of unsaturated fatty acids. The invention further relates to the use of DNA sequences coding for .DELTA.6-acetylenase/.DELTA.6-desaturases or .DELTA.6-desaturases for producing a transgenic organism, preferably a transgenic plant or a transgenic microorganism with increased content of fatty acids, oils or lipids with .DELTA.6 triple bonds and/or .DELTA.6 double bonds.

The invention additionally relates to an isolated nucleic acid sequence; to an expression cassette comprising a nucleic acid sequence, a vector and organisms comprising at least one nucleic acid sequence or expression cassette. The invention additionally relates to unsaturated fatty acids and triglycerides with an increased content of unsaturated fatty acids and the use thereof.

Fatty acids and triglycerides have a large number of uses in the food industry, in livestock nutrition, in cosmetics and in the drugs sector. They are suitable for a wide variety of uses depending on whether they are free saturated or unsaturated fatty acids or triglycerides with an increased content of saturated or unsaturated fatty acids; thus, for example, polyunsaturated fatty acids are added to baby food to increase the nutritional value. The various fatty acids and triglycerides are mainly obtained from microorganisms such as mortierella or from oil-producing plants such as soybean, oilseed rape, sunflower and others, usually resulting in the form of their triglycerides. However, they can also be obtained from animal species such as fish. The free fatty acids are advantageously prepared by saponification.

Depending on the purpose of use, oils with saturated or unsaturated fatty acids are preferred; thus, for example, lipids with unsaturated fatty acids, specifically polyunsaturated fatty acids, are preferred in human nutrition because they have a beneficial effect on the blood cholesterol level and thus on the possibility of having heart disease. They are used in various dietetic human foods or medicines.

Because of their beneficial properties, there has in the past been no lack of approaches to making available the genes involved in the synthesis of fatty acids and triglycerides for producing oils in various organisms with an altered content of unsaturated fatty acids. Thus, WO 91/13972 and its US equivalent describe a .DELTA.9-desaturase. WO 93/11245 claims a .DELTA.15-desaturase, and WO 94/11516 claims a .DELTA.12-desaturase. .DELTA.6-Desaturases are described in WO 93/06712, U.S. Pat. No. 5,614,393, WO 96/21022 and WO 99/27111. Further desaturases are described, for example, in EP-A-0 550 162, WO 94/18337, WO 97/30582, WO 97/21340, WO 95/18222, EP-A-0 794 250, Stukey et al., J. Biol. Chem., 265, 1990: 20144 21049, Wada et al., Nature 347, 1990: 200 203 or Huang et al., Lipids 34, 1999: 649 659. WO 96/13591 describes and claims a .DELTA.6-palmitoyl-ACP-desaturase. The biochemical characterization of the various desaturases is, however, to date inadequate because the enzymes can, as membrane-bound proteins, be isolated and characterized only with great difficulty (McKeon et al., Methods in Enzymol. 71, 1981: 12141 12147, Wang et al., Plant Physiol. Biochem., 26, 1988: 777 792).

WO 97/37033 describes a .DELTA.12-acetylenase. This enzyme can be used to prepare unsaturated C.sub.18-fatty acids with a triple bond. Besides the use in human foods, fatty acids of this type can also, because of their reactivity, be used to prepare polymers. Sperling et al. reported at a meeting (South Lake Tahoe, Canada, Jun. 9 13, 1999) on the cloning of an enzyme which likewise introduces triple bonds into fatty acids, but the substrates of this enzyme differ from those of the .DELTA.12-acetylenase, and the triple bond is introduced into a different position in the fatty acids by the enzyme.

It was possible to demonstrate in yeasts both a shift in the fatty acid spectrum toward unsaturated fatty acids, and an increase in the productivity (see Huang et al., Lipids 34, 1999: 649 659, Napier et al., Biochem. J., Vol. 330, 1998: 611 614). However, expression of the various desaturases in transgenic plants did not show the required result. It was possible to show a shift in the fatty acid spectrum toward unsaturated fatty acids, but it emerged at the same time that there was a great diminution in the synthetic performance of the transgenic plants, that is to say only small amounts of oils could be isolated by comparison with the initial plants.

There is thus still a great need for novel genes which code for enzymes which are involved in the biosynthesis of unsaturated fatty acids and make it possible to prepare the latter on an industrial scale.

It is an object of the present invention to provide further enzymes for the synthesis of conjugated unsaturated fatty acids.

We have found that this object is achieved by an isolated nucleic acid sequence which codes for a polypeptide having .DELTA.6-acetylenase and/or .DELTA.6-desaturase activity, selected from the group: a) of a nucleic acid sequence having the sequence depicted in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 11. b) nucleic acid sequences which, as a result of the degeneracy of the genetic code, are derived from the nucleic acid sequence depicted in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 11, c) derivatives of the nucleic acid sequence depicted in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 11, which code for polypeptides having the amino acid sequences depicted in SEQ ID NO: 2, and having at least 75% homology at the amino acid level with a negligible reduction in the enzymatic action of the polypeptides.

Derivative(s) mean, for example, functional homologs of the enzymes encoded by SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 11, or of their enzymatic activity, that is to say enzymes which catalyze the same enzymatic reactions as the enzymes encoded by SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 11. These genes likewise make it possible advantageously to prepare unsaturated fatty acids with triple bonds and/or double bonds in position 6. Unsaturated fatty acids mean hereinafter fatty acids with one or more unsaturations and with triple bonds and/or double bonds. The triple and/or double bonds may be conjugated or unconjugated. The sequences specified in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 11 code for novel enzymes having acetylenase and/or .DELTA.6-desaturase activity.

The novel enzyme .DELTA.6-acetylenase/.DELTA.6-desaturase advantageously introduces a cis double bond in position C.sub.6 C.sub.7 into fatty acid residues of glycerolipids and/or converts an already existing cis double bond in position C.sub.6 C.sub.7 into a triple bond (see SEQ ID NO: 1 or SEQ ID NO: 3). Furthermore, the enzyme has .DELTA..sup.6-desaturase activity which advantageously exclusively introduces a cis double bond in position C.sub.6 C.sub.7 into fatty acid residues of glycerolipids. The enzyme having the sequence specified in SEQ ID NO: 11 also has this activity and is a monofunctional .DELTA.6-desaturase.

The novel nucleic acid sequence(s) (the singular is intended to include the plural, and vice versa, for the application) or fragments thereof can be used advantageously for isolating further genomic sequences by homology screening.

The derivatives mentioned can be isolated, for example, from other organisms, e.g. eukaryotic organisms such as plants such as, specifically, mosses, dinoflagellates or fungi.

In addition, derivatives or functional derivatives of the sequences specified in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 11 mean, for example, allelic variants which, at the derived amino acid level, have at least 70% homology, advantageously at least 75% homology, preferably at least 80% homology, particularly preferably at least 85% homology, and very particularly preferably 90% homology. The homology has been calculated over the entire amino acid region. The program PileUp, BESTFIT, GAP, TRANSLATE or BACKTRANSLATE (=constituent of the UWGCG program package, Wisconsin Package, Version 10.0-UNIX, January 1999, Genetics Computer Group, Inc., Devereux et al., Nucleic Acids Res., 12, 1984: 387 395) was used (J. Mol. Evolution., 25, 351 350, 1987, Higgins et al., CABIOS, 5 1989: 151 153). The amino acid sequences derived from the specified nucleic acids are to be found in sequence SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 12. Homology means identity, that is to say the amino acid sequences are at least 70% identical. The novel sequences show at the nucleic acid level at least 65% homology, preferably at least 70%, particularly preferably 75%, very particularly preferably at least 80%.

Allelic variants comprise in particular functional variants which are obtainable from the sequence depicted in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 11 by deletion, insertion or substitution of nucleotides, with retention of the enzymatic activity of the derived synthesized proteins.

Such DNA sequences can be isolated starting from the DNA sequences described in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 11, or parts of these sequences, for example using conventional hybridization methods or the PCR technique, from other eukaryotes such as, for example, those mentioned above. These DNA sequences hybridize under standard conditions with the sequences mentioned. It is advantageous to use for the hybridization short oligonucleotides, for example of the conserved regions, which can be determined in a manner known to the skilled worker by comparisons with other acetylenase and/or desaturase genes. The histidine box sequences are advantageously used. However, it is also possible to use longer fragments of the novel nucleic acids or the complete sequences for the hybridization. These standard conditions vary depending on the nucleic acid used: oligonucleotide, longer fragment or complete sequence or depending on which type of nucleic acid, DNA or RNA, is used for the hybridization. Thus, for example, the melting temperatures for DNA:DNA hybrids are about 10.degree. C. lower than those for DNA:RNA hybrids of the same length.

Standard conditions mean, for example, depending on the nucleic acid, temperatures between 42 and 58.degree. C. in an aqueous buffer solution with a concentration between 0.1 and 5.times.SSC (1.times.SSC=0.15 M NaCl, 15 mM sodium citrate, pH 7.2) or additionally in the presence of 50% formamide, such as, for example, 42.degree. C. in 5.times.SSC, 50% formamide. The hybridization conditions for DNA:DNA hybrids are advantageously 0.1.times.SSC and temperatures between about 20.degree. C. and 45.degree. C., preferably between about 30.degree. C. and 45.degree. C. The hybridization conditions for DNA:RNA hybrids are advantageously 0.1.times.SSC and temperatures between about 30.degree. C. and 55.degree. C., preferably between about 45.degree. C. and 55.degree. C. These temperatures stated for the hybridization are melting temperatures calculated by way of example for a nucleic acid with a length of about 100 nucleotides and a G+C content of 50% in the absence of formamide. The experimental conditions for DNA hybridization are described in relevant textbooks of genetics such as, for example, Sambrook et al., "Molecular Cloning", Cold Spring Harbor Laboratory, 1989, and can be calculated by the formulae known to the skilled worker, for example depending on the length of the nucleic acids, the nature of the hybrids or the G+C content. Further information on hybridization can be found by the skilled worker in the following textbooks: Ausubel et al. (eds), 1985, Current Protocols in Molecular Biology, John Wiley & Sons, New York; Hames and Higgins (eds), 1985, Nucleic Acids Hybridization: A Practical Approach, IRL Press at Oxford University Press, Oxford; Brown (ed), 1991, Essential Molecular Biology: A Practical Approach, IRL Press at Oxford University Press, Oxford.

Derivatives also mean homologs of the sequence SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 11, for example eukaryotic homologs, truncated sequences, single-stranded DNA of the coding and noncoding DNA sequence or RNA of the coding and noncoding DNA sequence.

In addition, homologs of sequences SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 11 mean derivatives such as, for example, promoter variants. These variants can be modified by one or more nucleotide exchanges, by insertion(s) and/or deletion(s) without, however, impairing the functionality or efficacy of the promoters. The promoters may moreover have their efficacy increased by modification of their sequence, or be completely replaced by more effective promoters even from heterologous organisms.

Derivatives also advantageously mean variants whose nucleotide sequence in the region from -1 to -2000 in front of the start codon has been modified so that gene expression and/or protein expression is altered, preferably increased. Derivatives also mean variants modified at the 3' end.

Derivatives also mean antisense DNAs which can be used to inhibit the biosynthesis of the novel proteins. These antisense DNAs are among the novel nonfunctional derivatives such as derivatives having no enzymatic activity. Further methods known to the skilled worker for producing nonfunctional derivatives are so-called cosuppression, the use of ribozymes and introns. Ribozymes are catalytic RNA molecules with ribonuclease activity able to cut single-stranded nucleic acids such as mRNA, to which they show a complementarity. This makes it possible by using these ribozymes (Haselhoff and Gerlach, Nature, 334, 1988: 585 591) to cleave mRNA transcripts catalytically, and thus suppress translation of this mRNA. Ribozymes of this type can be tailored specifically for their tasks (U.S. Pat. No. 4,987,071; U.S. Pat. No. 5,116,742 and Bartel et al., Science 261, 1993: 1411 1418). It is thus possible by use of antisense DNA to prepare fatty acids, lipids or oils with an increased content of saturated fatty acids.

The novel nucleic acid sequences which code for a .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase can be prepared by synthesis or isolated from nature or comprise a mixture of synthetic and natural DNA constituents, and consist of various heterologous .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene sections from various organisms. In general, synthetic nucleotide sequences are produced using codons which are preferred by the appropriate host organisms, for example plants. This usually results in optimal expression of the heterologous genes. The plant-preferred codons may be determined from codons with the greatest protein frequency which are expressed in most plant species of interest. One example for Corynebacterium glutamicum is given in: Wada et al. (1992) Nucleic Acids Res. 20:2111 2118. Experiments of this type can be carried out by standard methods known to those skilled in the art.

Functionally equivalent sequences coding for the .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene are those derivatives of the novel sequences which, despite a different nucleotide sequence, still have the required functions, that is to say the enzymatic activity of the proteins. Functional equivalents thus comprise naturally occurring variants of the sequences described herein, and artificial nucleotide sequences, for example obtained by chemical synthesis and adapted to the codon usage of a plant.

In addition, artificial DNA sequences are suitable as long as they confer, as described above, the required property, for example the increase in the content of .DELTA.6 triple bonds or .DELTA.6 double bonds in fatty acids, oils or lipids in the plant by overexpression of the .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene in crop plants. Such artificial DNA sequences can be established, for example, by backtranslation by means of molecular modeling of constructed proteins which have .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase activity or by in vitro selection. Possible techniques for in vitro evolution of DNA for modifying or improving DNA sequences are described in Patten, P. A. et al., Current Opinion in Biotechnology 8, 724 733 (1997) or in Moore, J. C. et al., Journal of Molecular Biology 272, 336 347 (1997). Coding DNA sequences which have been obtained by backtranslation of a polypeptide sequence complying with the codon usage specific for the host plant are particularly suitable. The specific codon usage can easily be established by a skilled worker familiar with methods of plant genetics by computer analyses of other, known genes in the plant to be transformed.

Further suitable equivalent nucleic acid sequences which should be mentioned are sequences which code for fusion proteins, where a .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase polypeptide or a functional equivalent part thereof is a constituent of the fusion protein. The second part of the fusion protein can be, for example, another polypeptide with enzymatic activity or an antigenic polypeptide sequence with whose aid it is possible to detect .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase expression (e.g. myc tag or his tag). However, this is preferably a regulatory protein sequence such as, for example, a signal sequence for the ER, which guides the .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase protein to the required site of action.

It may be advantageous to combine the .DELTA.6-acetylenase/.DELTA.6-desaturase or .DELTA.6-desaturase genes in the novel process with other genes of fatty acid biosynthesis. Examples of such genes are the acetyltransferases, other desaturases or elongases. Advantageous for in vitro and specifically in vitro synthesis is combination with, for example, NADH cytochrome B5 reductases, which are able to take up or release reducing equivalents.

The novel amino acid sequences mean proteins which comprise an amino acid sequence depicted in sequences SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 12, or a sequence obtainable therefrom by substitution, inversion, insertion or deletion of one or more amino acid residues, with the enzymatic activity of the protein represented in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 12 being retained or negligibly reduced. Negligibly reduced means all enzymes which still have at least 10%, preferably 20%, particularly preferably 30%, of the enzymatic activity of the initial enzyme. It is moreover possible, for example, to replace particular amino acids by those having similar physicochemical properties (bulk, basicity, hydrophobicity etc.). For example, arginine residues are replaced by lysine residues, valine residues by isoleucine residues or aspartic acid residues by glutamic acid residues. However, it is also possible for one or more amino acids to be transposed in their sequence, added or deleted, or several of these measures can be combined together.

Derivatives also mean functional equivalents which comprise, in particular, also natural or artificial mutations of an originally isolated sequence coding for a .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase and which additionally show the required function, that is to say the enzymatic activity is negligibly reduced. Mutations comprise substitutions, additions, deletions, transpositions or insertions of one or more nucleotide residues. Thus, for example, the present invention also comprises those nucleotide sequences which are obtained by modification of the .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase nucleotide sequence. The aim of such a modification may be, for example, to localize further the coding sequence contained therein or, for example, also to insert further restriction enzyme cleavage sites.

Functional equivalents are also those variants whose function is, compared with the initial gene or gene fragment, attenuated (=negligibly reduced) or enhanced (=enzyme activity greater than the activity of the initial enzyme, that is to say the activity is over 100%, preferably over 110%, particularly preferably over 130%).

The nucleic acid sequence can moreover advantageously be, for example, a DNA or cDNA sequence. Coding sequences suitable for insertion into a novel expression cassette are, for example, those which code for a .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase having the sequences described above and which confer on the host the ability to overproduce fatty acids, oils or lipids with triple bonds and/or double bonds in position 6. These sequences may be of homologous or heterologous origin.

The novel expression cassette (=nucleic acid construct or fragment) means the sequences which are specified in SEQ ID NO: 1, SEQ ID NO: 3 or SEQ ID NO: 11 and which result from the genetic code and/or their functional or nonfunctional derivatives which advantageously have been functionally linked to one or more regulatory signals to increase gene expression and which control the expression of the coding sequence in the host cell. These regulatory sequences are intended to make specific expression of the genes and protein expression possible. This may mean, for example, depending on the host organism that the gene is expressed and/or overexpressed only after induction, or that it is expressed and/or overexpressed immediately. For example, these regulatory sequences are sequences to which inducers or repressors bind and thus regulate the expression of the nucleic acid. In addition to these novel regulatory sequences or in place of these sequences, it is possible for the natural regulation of these sequences still to be present in front of the actual structural genes and, where appropriate, to have been genetically modified so that the natural regulation has been switched off and the expression of the genes has been increased. However, the gene construct may also have a simpler structure, that is to say no additional regulatory signals have been inserted in front of the nucleic acid sequence or its derivatives, and the natural promoter with its regulation has not been deleted. Instead, the natural regulatory sequence has been mutated so that regulation no longer takes place and/or gene expression is increased. These modified promoters may also be placed alone in the form of part sequences (=promoter with parts of the novel nucleic acid sequences) in front of the natural gene to increase the activity. In addition, the gene construct may advantageously comprise one or more so-called enhancer sequences functionally linked to the promoter, which make increased expression of the nucleic acid sequence possible. It is also possible to insert additional advantageous sequences at the 3' end of the DNA sequences, such as further regulatory elements or terminators. The .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase genes may be present in one or more copies in the expression cassette (=gene construct).

The regulatory sequences or factors may moreover, as described above, preferably have a beneficial influence on expression of the inserted genes, and thus increase it. Thus, enhancement of regulatory elements can advantageously take place at the level of transcription by using strong transcription signals such as promoters and/or enhancers. However, it is also possible to enhance translation by, for example, improving the stability of the mRNA.

Suitable promoters in the expression cassette are in principle all promoters which are able to control the expression of foreign genes in organisms, advantageously in plants or fungi. It is preferable to use in particular plant promoters or promoters derived from a plant virus. Advantageous regulatory sequences for the novel process are present, for example, in promoters such as cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, lacI.sup.q, T7, T5, T3, gal, trc, ara, SP6, .lamda.-P.sub.R or in the .lamda.-P.sub.L promoter, which are advantageously used in Gram-negative bacteria. Further advantageous regulatory sequences are, for example, present in the Gram-positive promoters amy and SPO2, in the yeast or fungal promoters ADC1, MF.alpha., AC, P-60, CYC1, GAPDH, TEF, rp28, ADH or in the plant promoters such as CaMV/35S [Franck et al., Cell 21(1980) 285 294], SSU, OCS, lib4, STLS1, B33, nos (=nopaline synthase promoter) or in the ubiquitin promoter. The expression cassette may also comprises a chemically inducible promoter by which expression of the exogenous .DELTA.6-ACETYLENASE/.DELTA.6-DESATURASE and/or .DELTA.6-DESATURASE gene in the organism, advantageously in the plants, can be controlled at a particular time. Examples of such advantageous plant promoters are the PRP1 promoter [Ward et al., Plant. Mol. Biol. 22(1993), 361 366], a benzenesulfonamide-inducible (EP 388186), a tetracycline-inducible (Gatz et al., (1992) Plant J. 2, 397 404), a salicylic acid-inducible promoter (WO 95/19443), an abscisic acid-inducible (EP335528) or an ethanol- or cyclohexanone-inducible (WO93/21334) promoter. Further examples of plant promoters which can advantageously be used are the promoter of the cytosolic FBPase from potato, the ST-LSI promoter from potato (Stockhaus et al., EMBO J. 8 (1989) 2445 245 [lacuna]), the promoter of phosphoribosyl-pyrophosphate amidotransferase from Glycine max (see also Genbank Accession Number U87999) or a node-specific promoter as in EP 249676. Particularly advantageous plant promoters are those which ensure expression in tissues or plant parts/organs in which fatty acid biosynthesis of its precursors takes place, such as, for example, in the endosperm or in the developing embryo. Particular mention should be made of advantageous promoters which ensure seed-specific expression, such as, for example, the USP promoter or derivatives thereof, the LEB4 promoter, the phaseolin promoter or the napin promoter. The particularly advantageous USP promoter or its derivatives mediate gene expression very early in seed development (Baeumlein et al., Mol Gen Genet, 1991, 225 (3): 459 67). Further advantageous seed-specific promoters which can be used for monocotyledonous and dicotyledonous plants are the promoters suitable for dicotyledons, such as the napin gene promoter from oilseed rape (U.S. Pat. No. 5,608,152), the oleosin promoter from arabidopsis (WO98/45461), the phaseolin promoter from Phaseolus vulgaris (U.S. Pat. No. 5,504,200), the Bce4 promoter from brassica (WO91/13980) or the legume B4 promoter (LeB4, Baeumlein et al., Plant J., 2, 2, 1992: 233 239) or promoters suitable for monocotyledons, such as the promoters of the lpt2 or lpt1 gene from barley (WO95/15389 and WO95/23230) or the promoters of the barley hordein gene, of the rice glutelin gene, of the rice oryzin gene, of the rice prolamin gene, of the wheat gliadin gene, of the wheat glutelin gene, of the corn zein gene, of the oats glutelin gene, of the sorghum kasirin gene or of the rye secalin gene, which are described in WO99/16890.

Further particularly preferred promoters are those which ensure expression in tissues or plant parts in which, for example, the biosynthesis of fatty acids, oils and lipids or their precursors takes place. Particular mention should be made of promoters which ensure seed-specific expression. Mention should be made of the promoter of the napin gene from oilseed rape (U.S. Pat. No. 5,608,152), the USP promoter from Vicia faba (USP=unknown seed protein, Baeumlein et al., Mol Gen Genet, 1991, 225 (3): 459 67), of the oleosin gene from arabidopsis (WO98/45461), of the phaseolin promoter (U.S. Pat. No. 5,504,200) or of the promoter of the legumin B4 gene (LeB4; Baeumlein et al., 1992, Plant Journal, 2 (2): 233 9). Mention should further be made of promoters such as that of the lpt2 or lpt1 gene from barley (WO95/15389 and WO95/23230), which confers seed-specific expression in monocotyledonous plants.

The expression cassette (=gene construct, nucleic acid construct) may, as described above, comprise other genes which are to be introduced into the organisms. These genes may be under separate regulation or under the same regulatory region as the genes of .DELTA.6-ACETYLENASE/.DELTA.6-DESATURASE and/or .DELTA.6-DESATURASE. Examples of these genes are further biosynthesis genes, advantageously of fatty acid biosynthesis, which make increased synthesis possible. Examples which may be mentioned are the genes for the .DELTA.15-, .DELTA.12-, .DELTA.9-, .DELTA.6-, and .DELTA.5-desaturases, the various hydroxylases, the .DELTA.12-acetylenase, the acyl ACP thioesterases, .beta.-ketoacyl ACP synthases or .beta.-ketoacyl ACP reductases. It is advantageous to use the desaturase genes in the nucleic acid construct.

It is possible in principle for all natural promoters with their regulatory sequences like those mentioned above to be used for the novel expression cassette and the novel process, as described below. It is also possible and advantageous moreover to use synthetic promoters.

For preparation of an expression cassette, it is possible to manipulate various DNA fragments in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame. To link the DNA fragments (=novel nucleic acids) together it is possible to attach adaptors or linkers to the fragments.

It is possible and expedient for the promoter and terminator regions to be provided in the direction of transcription with a linker or polylinker which contains one or more restriction sites for insertion of this sequence. The linker ordinarily has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. The size of the linker within the regulatory region is generally less than 100 bp, frequently less than 60 bp, but at least 5 bp. The promoter may be both native or homologous and foreign or heterologous in relation to the host organism, for example to the host plant. The expression cassette comprises in the 5'-3' direction of transcription the promoter, a DNA sequence which codes for a .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene, and a region for transcription termination. Various termination regions can replace one another as desired.

A further possibility is to employ manipulations which provide appropriate restriction cleavage sites or delete excess DNA or restriction cleavage sites. When it is a question of insertions, deletions or substitutions such as, for example, transitions and transversions, it is possible to use in vitro mutagenesis, primer repair, restriction or ligation. It is possible with suitable manipulations such as, for example, restriction, chewing back or filling in overhangs for blunt ends to provide complementary ends of the fragments for the ligation.

Attachment of the specific ER retention signal SEKDEL may, inter alia, be important for advantageous high-level expression (Schouten, A. et al., Plant Mol. Biol. 30 (1996), 781 792), this tripling or quadrupling the average level of expression. It is also possible to employ other retention signals which occur naturally with plant and animal proteins which are localized in the ER for constructing the cassette.

Preferred polyadenylation signals are plant polyadenylation signals, preferably those essentially corresponding to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular of gene 3 of the T-DNA (octopine synthase) of the Ti plasmid pTiACH5 (Gielen et al., EMBO J. 3 (1984), 835 ff) or corresponding functional equivalents.

An expression cassette is prepared by fusing a suitable promoter to a suitable .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase DNA sequence and to a polyadenylation signal by conventional recombination and cloning techniques as described, for example, in T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1989) and in T. J. Silhavy, M. L. Berman and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1984) and in Ausubel, F. M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Interscience (1987).

For preparation of an expression cassette, it is possible to manipulate various DNA fragments in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame. To link the DNA fragments together it is possible to attach adaptors or linkers to the fragments.

It is possible and expedient for the promoter and terminator regions to be provided in the direction of transcription with a linker or polylinker which contains one or more restriction sites for insertion of this sequence. The linker ordinarily has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. The size of the linker within the regulatory region is generally less than 100 bp, frequently less than 60 bp, but at least 5 bp. The promoter may be both native or homologous and foreign or heterologous in relation to the host plant. The expression cassette comprises in the 5'-3' direction of transcription the promoter, a DNA sequence which codes for a .DELTA.6-acetylenase/desaturase gene, and a region for transcription termination. Various termination regions can replace one another as desired.

For preparation of an expression cassette, it is possible to manipulate various DNA fragments in order to obtain a nucleotide sequence which expediently reads in the correct direction and which is equipped with a correct reading frame. To link the DNA fragments together it is possible to attach adaptors or linkers to the fragments.

It is possible and expedient for the promoter and terminator regions to be provided in the direction of transcription with a linker or polylinker which contains one or more restriction sites for insertion of this sequence. The linker ordinarily has 1 to 10, usually 1 to 8, preferably 2 to 6, restriction sites. The size of the linker within the regulatory region is generally less than 100 bp, frequently less than 60 bp, but at least 5 bp. The promoter may be both native or homologous and foreign or heterologous in relation to the host plant. The expression cassette comprises in the 5'-3' direction of transcription the promoter, a DNA sequence which codes for a .DELTA.6-acetylenase/.DELTA.6-desaturase or .DELTA.6-desaturase gene, and a region for transcription termination. Various termination regions can replace one another as desired.

The DNA sequence coding for a .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase from Ceratodon purpureus comprises all the sequence features necessary to achieve a localization correct for the site of fatty acid, lipid or oil biosynthesis. Thus no other targeting sequences are necessary per se. However, such a localization may be desirable and advantageous and therefore be artificially modified or enhanced so that such fusion constructs are also a preferred and advantageous embodiment of the invention.

Particularly preferred sequences are those ensuring targeting in plastids. In certain circumstances, targeting in other components (reported: Kermode, Crit. Rev. Plant Sci. 15, 4 (1996), 285 423), for example in the vacuoles, in the mitrochondrium, in the endoplasmic reticulum (ER), peroxisomes, lipid bodies or, through absence of appropriate operative sequences, remaining in the compartment of production, the cytosol, may also be desirable.

It is advantageous for the novel nucleic acid sequences to be cloned together with at least one reporter gene into an expression cassette which is introduced into the organism via a vector or directly into the genome. This reporter gene should make easy detection possible by a growth, fluorescence, chemo- or bioluminescence or resistance assay or by a photometric measurement. Examples of reporter genes which may be mentioned are antibiotic- or herbicide-resistance genes, hydrolase genes, fluorescent protein genes, bioluminescence genes, sugar or nucleotide metabolism genes or biosynthesis genes such as the Ura3 gene, the Ilv2 gene, the luciferase gene, the .beta.-galactosidase gene, the gfp gene, the 2-deoxyglucose-6-phosphate phosphatase gene, the .beta.-glucuronidase gene, .beta.-lactamase gene, the neomycin phosphotransferase gene, the hygromycin phosphotransferase gene or the BASTA (=glufosinate-resistance) gene. These genes make it possible easily to measure and quantify the transcription activity and thus the expression of the genes. It is thus possible to identify sites in the genome which show differences in productivity.

In a preferred embodiment, an expression cassette comprises a promoter upstream, i.e. at the 5' end of the coding sequence, and a polyadenylation signal downstream, i.e. at the 3' end, and, where appropriate, further regulatory elements which are operatively linked to the coding sequence in between for the .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase DNA sequence. Operative linkage means the sequential arrangement of promoter, coding sequence, terminator and, where appropriate, further regulatory elements in such a way that each of the regulatory elements can carry out its function as intended in the expression of the coding sequence. The sequences preferred for the operative linkage are targeting sequences to ensure subcellular localization in plastids. However, targeting sequences to ensure subcellular localization in the mitochondrium, in the endoplasmic reticulum (ER), in the cell nucleus, in elaioplasts or other compartments can also be employed if required, as well as translation enhancers such as the 5' leader sequence from tobacco mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693 8711).

An expression cassette may comprise, for example, a constitutive promoter (preferably the USP or napin promoter), the gene to be expressed and the ER retention signal. The ER retention signal preferably used is the amino acid sequence KDEL (lysine, aspartic acid, glutamic acid, leucine).

For expression, the expression cassette is inserted into a prokaryotic or eukaryotic host organism, for example a microorganism such as a fungus or a plant, advantageously into a vector such as, for example, a plasmid, a phage or other DNA, which enables the genes to be optimally expressed in the host organism. Examples of suitable plasmids are in E. coli pLG338, pACYC184, pBR series such as, for example, pBR322, pUC series such as pUC18 or pUC19, M113mp series, pKC30, pRep4, pHS1, pHS2, pPLc236, pMBL24, pLG200, pUR290, pIN-III.sup.113-B1, .lamda.gt11 or pBdCI, in streptomyces pIJ101, pIJ364, pIJ702 or pIJ361, in bacillus pUB110, pC194 or pBD214, in corynebacterium pSA77 or pAJ667, in fungi pALS1, pIL2 or pBB116, further advantageous fungal vectors being described by Romanos, M. A. et al., [(1992) "Foreign gene expression in yeast: a review", Yeast 8: 423 488] and van den Hondel, C. A. M. J. J. et al. [(1991) "Heterologous gene expression in filamentous fungi] and in More Gene Manipulations in Fungi [J. W. Bennet & L. L. Lasure, eds., p. 396 428: Academic Press: San Diego] and in "Gene transfer systems and vector development for filamentous fungi" [van den Hondel, C. A. M. J. J. & Punt, P. J. (1991) in: Applied Molecular Genetics of Fungi, Peberdy, J. F. et al., eds., p. 1 28, Cambridge University Press: Cambridge]. Examples of advantageous yeast promoters are 2 .mu.M, pAG-1, YEp6, YEp13 and pEMBLYe23. Examples of algal or plant promoters are pLGV23, pGHlac.sup.+, pBIN19, pAK2004, pVKH and pDH51 (see Schmidt, R. and Willmitzer, L., 1988). The abovementioned vectors or derivatives of the aforementioned vectors represent a small selection of the possible plasmids. Further plasmids are well known to the skilled worker and can be found, for example, in the book Cloning Vectors (Eds. Pouwels P. H. et al. Elsevier, Amsterdam-New York-Oxford, 1985, ISBN 0 444 904018). Suitable plant vectors are described inter alia in "Methods in Plant Molecular Biology and Biotechnology" (CRC Press), Chapters 6/7, pp. 71 119. Advantageous vectors are shuttle vectors or binary vectors which replicate in E. coli and Agrobacterium.

Apart from plasmids, vectors also mean all other vectors known to the skilled worker, such as, for example, phages, viruses such as SV40, CMV, baculovirus, adenovirus, transposons, IS elements, phasmids, phagemids, cosmids, linear or circular DNA. These vectors are capable of autonomous replication or chromosomal replication in the host organism; chromosomal replication is preferred.

In a further embodiment of the vector, the novel expression cassette can also advantageously be introduced in the form of a linear DNA into the organisms and be integrated by heterologous or homologous recombination into the genome of the host organism. This linear DNA may consist of a linearized plasmid or only of the expression cassette as vector or the novel nucleic acid sequences.

In a further advantageous embodiment, the novel nucleic acid sequence can also be introduced alone into an organism.

If further genes, in addition to the novel nucleic acid sequence, are to be introduced into the organism, it is possible to introduce all together with a reporter gene in a single vector or each individual gene with a reporter gene in one vector in each case into the organism, in which case the various vectors can be introduced simultaneously or successively.

The vector advantageously comprises at least one copy of the novel nucleic acid sequences and/or of the novel expression cassette.

It is possible for example to incorporate the plant expression cassette into the tobacco transformation vector pBinAR. FIG. 1 shows the tobacco transformation vectors pBinAR with 35S promoter (C) and pBin-USP with the USP promoter (D). The initial vectors are depicted in FIG. 1 A) and B).

An alternative possibility is also in vitro transcription and translation of a recombinant vector (=expression vector), for example by using the T7 promoter and T7 RNA polymerase.

Expression vectors used in prokaryotes frequently make use of inducible systems with and without fusion proteins or fusion oligopeptides, it being possible for these fusions to take place both N-terminally and C-terminally or on other domains which can be used in a protein. Fusion vectors of this type are usually employed for: i.) increasing the RNA expression rate, ii.) increasing the protein synthesis rate which can be achieved, iii.) increasing the solubility of the protein, or iv.) simplifying the purification by a binding sequence which can be used for affinity chromatography. Proteolytic cleavage sites are frequently also introduced via fusion proteins, enabling elimination of a part of the fusion protein also of the purification. Such recognition sequences for proteases recognize, for example, factor Xa, thrombin and enterokinase.

Typical advantageous fusion and expression vectors are pGEX [Pharmacia Biotech Inc; Smith, D. B. and Johnson, K. S. (1988) Gene 67: 31 40], pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) which comprises glutathione S-transferase (GST), maltose binding protein, or protein A.

Further examples of E. coli expression vectors are pTrc [Amann et al., (1988) Gene 69:301 315] and pET vectors [Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 60 89; Stratagene, Amsterdam, The Netherlands].

Further advantageous vectors for use in yeasts are pYepSec1 (Baldari, et al., (1987) Embo J. 6:229 234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933 934), pJRY88 (Schultz et al., (1987) Gene 54:113 123), and pYES derivatives (Invitrogen Corporation, San Diego, Calif.). Vectors for use in filamentous fungi are described in: van den Hondel, C. A. M. J. J. & Punt, P. J. (1991) "Gene transfer systems and vector development for filamentous fungi", in: Applied Molecular Genetics of Fungi, J. F. Peberdy, et al., eds., p. 1 28, Cambridge University Press: Cambridge.

An alternative and advantageous possibility is also to use insect cell expression vectors, e.g. for expression in Sf 9 cells. Examples thereof are the vectors of the pAc series (Smith et al. (1983) Mol. Cell Biol. 3:2156 2165) and of the pVL series (Lucklow and Summers (1989) Virology 170:31 39).

It is additionally possible and advantageous to use plant cells or algal cells for the gene expression. Examples of plant expression vectors are to be found in Becker, D., et al. (1992) "New plant binary vectors with selectable markers located proximal to the left border", Plant Mol. Biol. 20: 1195 1197 or in Bevan, M. W. (1984) "Binary Agrobacterium vectors for plant transformation", Nucl. Acid. Res. 12: 8711 8721.

The novel nucleic acid sequences may also be expressed in mammalian cells. Examples of appropriate expression vectors are pCDM8 and pMT2PC, mentioned in: Seed, B. (1987) Nature 329:840 or Kaufman et al. (1987) EMBO J. 6: 187 195). In these cases, the promoters preferably used are of viral origin such as, for example, promoters of polyomavirus, adenovirus 2, cytomegalovirus or simian virus 40. Further prokaryotic and eukaryotic expression systems are mentioned in Chapters 16 and 17 in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.

The introduction of the novel nucleic acids, of the expression cassette or of the vector into organisms, for example into plants, can in principle take place by all methods known to the skilled worker.

The skilled worker can find appropriate methods for microorganisms in the textbooks by Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, by F. M. Ausubel et al. (1994) Current protocols in molecular biology, John Wiley and Sons, by D. M. Glover et al., DNA Cloning Vol. 1, (1995), IRL Press (ISBN 019-963476-9), by Kaiser et al. (1994) Methods in Yeast Genetics, Cold Spring Harbor Laboratory Press or Guthrie et al., Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, 1994, Academic Press.

The transfer of foreign genes into the genome of a plant is referred to as transformation. In this case, the methods described for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation are utilized. Suitable methods are protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene gun--the so-called particle bombardment method, electroporation, incubation of dry embryos in DNA-containing solution, microinjection and agrobacterium-mediated gene transfer. The methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S. D. Kung and R. Wu, Academic Press (1993) 128 143 and in Potrykus Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991) 205 225. The construct to be expressed is preferably cloned into a vector which is suitable for transforming Agrobacterium tumefaciens, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984) 8711). Agrobacteria transformed with such a vector can then be used in a known manner for transforming plants, in particular crop plants such as, for example, tobacco plants, by, for example, bathing wounded leaves or pieces of leaves in a solution of agrobacteria and then cultivating in suitable media. Transformation of plants with Agrobacterium tumefaciens is described, for example, by Hofgen and Willmitzer in Nucl. Acids Res. (1988) 16, 9877, or is disclosed inter alia in F. F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S. D. Kung and R. Wu, Academic Press, 1993, pp. 15 38.

Agrobacteria transformed with a novel expression vector can likewise be used in a known manner for transforming plants such as test plants such as arabidopsis or crop plants such as cereals, corn, oats, rye, barley, wheat, soybean, rice, cotton, sugarbeet, canola, sunflower, flax, hemp, potato, tobacco, tomato, carrot, paprika, oilseed rape, tapioca, manioc, arrowroot, tagetes, alfalfa, lettuce and the various tree, nut and vine species, in particular oil-bearing crop plants such as soybean, peanut, ricinus, sunflower, corn, cotton, flax, oilseed rape, coconut, oil palm, safflower (Carthamus tinctorius) or cocoa bean, e.g. by bathing wounded leaves or pieces of leaves in a solution of agrobacteria and then cultivating in suitable media.

The genetically modified plant cells can be regenerated by all methods known to the skilled worker. Appropriate methods can be found in the abovementioned publications by S. D. Kung and R. Wu, Potrykus or Hofgen and Willmitzer.

Organisms or host organisms suitable and advantageous in principle for the novel nucleic acid, the expression cassette or the vector are all organisms able to synthesize fatty acids, specifically unsaturated fatty acids, or suitable for expressing recombinant genes. Examples which may be mentioned are plants such as arabidopsis, asteraceae such as calendula or crop plants such as soybean, peanut, ricinus, sunflower, corn, cotton, flax, oilseed rape, coconut, oil palm, safflower (Carthamus tinctorius) or cocoa bean, microorganisms such as fungi, for example the genus Mortierella, Saprolegnia or Pythium, bacteria such as the genus Escherichia, yeasts such as the genus Saccharomyces, cyanobacteria, ciliates, algae or protozoa such as dinoflagellates such as crypthecodinium. Preference is given to organisms able naturally to synthesize oils in relatively large amounts, such as fungi such as Mortierella alpina, Pythium insidiosum or plants such as soybean, oilseed rape, coconut, oil palm, safflower, ricinus, calendula, peanut, cocoa bean or sunflower or yeasts such as Saccharomyces cerevisiae, and particular preference is given to soybean, oilseed rape, sunflower, calendula or Saccharomyces cerevisiae. Transgenic animals are also suitable in principle as host organisms, for example C. elegans.

Host cells which can be used are also mentioned in: Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990).

Expression strains which can be used, for example those having a relatively low protease activity, are described in: Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 119 128.

The invention further relates to the use of an expression cassette comprising DNA sequences coding for a .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene or DNA sequences hybridizing with the latter for the transformation of plant cells or tissues or parts of plants. The use is aimed at increasing the content of fatty acids, oils or lipids with an increased content of triple bonds and double bond in position 6.

It is moreover possible, depending on the choice of the promoter, for expression of the .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene to take place specifically in the leaves, in the seeds, the tubers or other parts of the plant. Transgenic plants overproducing such fatty acids, oils or lipids with .DELTA.6 triple bonds or .DELTA.6 double bonds, their propagation material, and their plant cells, tissues or parts are a further aspect of the present invention. The invention preferably relates to transgenic plants comprising a novel functional or nonfunctional (=antisense DNA or enzymatically inactive enzyme) nucleic acid sequence or a functional or nonfunctional expression cassette.

The expression cassette or the novel nucleic acid sequences comprising a .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene sequence can moreover be used to transform the organisms mentioned above by way of example, such as bacteria, cyanobacteria, yeasts, filamentous fungi, ciliates and algae with the aim of increasing the content of fatty acids, oil or lipids with .DELTA.6 triple bonds or .DELTA.6 double bonds.

Increasing the content of fatty acids, oils or lipids with .DELTA.6 triple bonds or .DELTA.6 double bonds means for the purpose of the present invention for example the artificially acquired capability of increased biosynthetic activity through functional overexpression of the .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene in the novel organisms, advantageously in the novel transgenic plants, compared with the initial plants without genetic modification, at least for the duration of at least one plant generation.

The site of biosynthesis of fatty acids, oils or lipids for example is generally the seed or cellular layers of the seed, so that seed-specific expression of the .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene is sensible. However, it is obvious that biosynthesis of fatty acids, oils or lipids need not be restricted to the seed tissue but may also take place in a tissue-specific manner in all other parts of the plants--for example in epidermis cells or in the tubers.

In addition, constitutive expression of the exogenous .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene is advantageous. However, on the other hand, inducible expression may also appear desirable.

The effectiveness of expression of the transgenic .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene can be determined, for example, in vitro by shoot meristem propagation. In addition, an alteration in the nature and level of expression of the .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene and its effect on fatty acid, oil or lipid biosynthetic activity can be tested in glasshouse experiments on test plants.

The invention additionally relates to transgenic plants transformed with an expression cassette comprising a .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene sequence or DNA sequences hybridizing with the latter, and to transgenic cells, tissues, parts and propagation material of such plants. Particularly preferred in this connection are transgenic crop plants such as, for example, barley, wheat, rye, oats, corn, soybean, rice, cotton, sugarbeet, oilseed rape and canola, sunflower, flax, hemp, potato, tobacco, tomato, tapioca, manioc, arrowroot, alfalfa, lettuce and the various tree, nut and vine species.

Plants for the purpose of the invention are mono- and dicotyledonous plants or algae.

Another novel embodiment comprises the transgenic plants which are described above and which comprise a functional or nonfunctional novel nucleic acid sequence or a functional or nonfunctional novel expression cassette. Nonfunctional means that there is no longer synthesis of an enzymatically active protein. In addition, nonfunctional nucleic acids or nucleic acid constructs also mean a so-called antisense DNA which results in transgenic plants which show a reduction in the enzymatic activity or no enzymatic activity. The antisense technique can be used, especially when the novel nucleic acid sequence is combined with other fatty acid synthesis genes in the antisense DNA, to synthesize triglycerides with an increased content of saturated fatty acids or to synthesize saturated fatty acids. Transgenic plants mean individual plant cells and their cultures on solid media or in liquid culture, parts of plants and whole plants.

The invention further relates to: A process for transforming a plant, which comprises introducing expression cassettes comprising a .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase gene sequence or DNA sequences hybridizing with the latter into a plant cell, into callus tissue, a whole plant or protoplasts of plants. The use of .DELTA.6-acetylenase/.DELTA.6-desaturase and/or .DELTA.6-desaturase DNA gene sequence or DNA sequences hybridizing with the latter for producing plants with an increased content of fatty acids, oils or lipids with triple bonds or delta-6 double bonds by expressing this .DELTA.6-acetylenase/desaturase DNA in plants. A protein comprising the amino acid sequence depicted in SEQ ID NO: 8. A protein comprising the amino acid sequence depicted in SEQ ID NO: 10. The use of the proteins having the sequences SEQ ID NO: 8 and SEQ ID NO: 10 for producing unsaturated fatty acids.

The invention further relates to a process for producing unsaturated fatty acids, which comprises introducing at least one novel nucleic acid sequence described above or at least one novel nucleic acid construct into a preferably oil-producing organism, culturing this organism and isolating the oil contained in the organism, and liberating the fatty acids contained in the oil. These unsaturated fatty acids advantageously contain .DELTA.6 triple and/or .DELTA.6 double bonds. The fatty acids can also be liberated from the oils or lipids for example by basic hydrolysis, for example with NaOH or KOH.

The invention additionally relates to a process for preparing triglycerides with an increased content of unsaturated fatty acids, which comprises introducing at least one novel nucleic acid sequence described above or at least one novel expression cassette into an oil-producing organism, culturing this organism, and isolating the oil contained in the organism.

The invention further relates to a process for the preparation of triglycerides with an increased content of unsaturated fatty acids by incubating triglycerides with saturated or unsaturated or saturated and unsaturated fatty acids with at least one of the proteins encoded by one of the sequences SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 10 or SEQ ID NO: 11. The process is advantageously carried out in the presence of compounds able to take up or release reducing equivalents. The fatty acids can then be liberated from the triglycerides.

A process as claimed in claim 16 or 17, wherein the fatty acids are liberated from the triglycerides.

The abovementioned processes advantageously make it possible to synthesize fatty acids or triglycerides with an increased content of fatty acids with .DELTA.6 triple and/or .DELTA.6 double bonds.

The so-called antisense technology can be used in a process also to prepare fatty acids or triglycerides with an increased content of saturated fatty acids.

Examples of organisms which may be mentioned for said processes are plants such as arabidopsis, barley, wheat, rye, oats, corn, soybean, rice, cotton, sugarbeet, oilseed rape and canola, sunflower, flax, hemp, potato, tobacco, tomato, tapioca, manioc, arrowroot, alfalfa, peanut, ricinus, coconut, oil palm, safflower (Carthamus tinctorius) or cocoa bean, microorganisms such as the fungi Mortierella, Saprolegnia or Pythium, bacteria such as the genus Escherichia, cyanobacteria, yeasts such as the genus Saccharomyces, algae or protozoa such as dinoflagellates such as crypthecodinium. Organisms able naturally to synthesize oils in relatively large amounts are preferred, such as microorganisms such as fungi such as Mortierella alpina, Pythium insidiosum or plants such as soybean, oilseed rape, coconut, oil palm, safflower, ricinus, calendula, peanut, cocoa bean or sunflower or yeasts such as Saccharomyces cerevisiae; particular preference is given to soybean, oilseed rape, sunflower, carthamus or Saccharomyces cerevisiae.

The organisms used in the processes are grown or cultured in a manner known to the skilled worker, depending on the host organism. Microorganisms are ordinarily cultured in a liquid medium which contains a source of carbon, usually in the form of sugars, a source of nitrogen, usually in the form of organic sources of nitrogen, such as yeast extract or salts such as ammonium sulfate, trace elements such as iron, manganese, magnesium salts and, where appropriate, vitamins, at temperatures between 0.degree. C. and 100.degree. C., preferably between 10.degree. C. and 60.degree. C., while passing in oxygen. The pH of the nutrient liquid can be kept at a fixed value during this, that is to say controlled during the cultivation, or not. The cultivation can be carried out batchwise, semibatchwise or continuously. Nutrients can be introduced at the start of the fermentation or be subsequently fed in semicontinuously or continuously.

After transformation, plants are initially regenerated as described above and then cultured or grown in a usual way.

After cultivation, the lipids are isolated from the organisms in the usual way. For this purpose, the organisms can after harvesting be initially disrupted or used directly. The lipids are advantageously extracted with suitable solvents such as apolar solvents such as hexane or ethanol, isopropanol or mixtures such as hexane/isopropanol, phenol/chloroform/isoamyl alcohol at temperatures between 0.degree. C. and 80.degree. C., preferably between 20.degree. C. and 50.degree. C. The biomass is ordinarily extracted with an excess of solvent, for example a 1:4 excess of solvent relative to biomass. The solvent is subsequently removed, for example by distillation. The extraction can also take place with supercritical CO.sub.2. The biomass remaining after the extraction can be removed, for example, by filtration.

The crude oil obtained in this way can then be further purified, for example by removing turbidity by adding polar solvents such as acetone or chloroform and subsequently filtering or centrifuging. Further purification on columns is also possible.

To isolate the free fatty acids from the triglycerides, the latter are hydrolyzed in a usual way.

The invention further relates to unsaturated fatty acids and triglycerides with an increased content of unsaturated fatty acids which have been prepared by the abovementioned processes, and to the use thereof for producing human foods, animal feed, cosmetics or pharmaceuticals. For these purposes, they are added to the human foods, the animal feed, the cosmetics or pharmaceuticals in conventional amounts.

The invention is explained in detail by the following examples:

EXAMPLES

Example 1

General Cloning Methods

The cloning methods such as, for example, restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linkage of DNA fragments, transformation of Escherichia coli cells, cultivation of bacteria and recombinant DNA sequence analysis were carried out as described by Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6).

Example 2

Recombinant DNA Sequence Analysis

Recombinant DNA molecules were sequenced using an ABI laser fluorescence DNA sequencer by the method of Sanger (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74, 5463 5467). Fragments resulting from a polymerase chain reaction were sequenced and checked to avoid polymerase errors in constructs to be expressed.

Example 3

Generation of Transgenic Oilseed Rape Plants (Modified Method of Moloney et al., 1992, Plant Cell Reports, 8:238 242)

Transgenic oilseed rape plants were generated using binary vectors in Agrobacterium tumefaciens C58C1:pGV2260 or Escherichia coli (Deblaere et al., 1984, Nucl. Acids. Res. 13, 4777 4788). Oilseed rape plants (Var. Drakkar, NPZ Nordeutsche Pflanzenzucht, Hohenlieth, Germany) were transformed by using a 1:50 dilution of an overnight culture of a positively transformed agrobacteria colony in Murashige-Skoog medium (Murashige and Skoog 1962 Physiol. Plant. 15, 473) with 3% sucrose (3MS medium). Petioles or hypocotyledons from freshly germinated sterile oilseed rape plants (about 1 cm.sup.2 each) were incubated with a 1:50 dilution of agrobacteria in a Petri dish for 5 10 minutes. This was followed by incubation on 3MS medium with 0.8% Bacto agar at 25.degree. C. in the dark for 3 days. After 3 days, cultivation was continued with 16 hours of light/8 hours of dark and, in a weekly rhythm, continued on MS medium with 500 mg/l Claforan (cefotaxime sodium), 50 mg/l kanamycin, 20 microM benzylaminopurine (BAP) and 1.6 g/l glucose. Growing shoots were transferred to MS medium with 2% sucrose, 250 mg/l Claforan and 0.8% Bacto agar. If no roots formed after three weeks, the growth hormone 2-indolebutyric acid was added to the medium for rooting.

Example 4

Generation of Transgenic Arabidopsis thaliana Plants

Arabidopsis thaliana var. Columbia Col 0 (Lehle Seeds, Round Rock, Tex., USA) was transformed by the flower infiltration method described by: Bechtold, N., Ellis, J. and Pelletier, G. in Planta, Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants, C. R. Acad. Sci. Paris, Life Sciences 316 (1993), 1194 119 [lacuna] or by the root transformation method.

Example 5

Corn plants were transformed as described by Pareddy, D., Petolino, J., Skokut, T., Hopkins, N., Miller, M., Welter, M., Smith, K., Clayton, D., Pescitelli, S., Gould, A., Maize Transformation via Helium Blasting. Maydica. 42(2): 143 154, 1997.

Example 6

Isolation and Cloning of .DELTA.6-acetylenase/.DELTA.6-desaturase and .DELTA.6-desaturase from Ceratodon purpureus

In order to isolate DNA sequences from Ceratodon purpureus which encode a .DELTA.6-acetylenase/.DELTA.6-desaturase and a .DELTA..sup.6-desaturase, various degenerate oligonucleotide primers were derived from DNA sequences which encode .DELTA.5- (EMBL Accession No. Z81122) and .DELTA.6-fatty acid desaturases (U79010, AJ222980, AF031477: Primer A: 5' - TGG TGG AA(A/G) TGG A(A/C)I CA(C/T) AA - 3' (SEQ ID NO:13) forward primer, deduced from the amino acid sequence WWKW (N/T/K) H(N/K) Primer B: 5' - (T/G)GI TGG AA(A/G) (T/G) (G/A)I (A/C)AI CA(C/T) AA - 3'' (SEQ ID NO:14) forward primer, deduced from the amino acid sequence (G/W) WK (E/D/W) (N/Q/K)H(N/K) Primer C: 5' -AT (A/T/G/C)T(T/G) (A/T/G/C)GG (A/G)AA (A/T/G/C)A(A/G) (A/G)TG (A/G)TG - 3' (SEQ ID NO: 15), reverse primer, deduced from the amino acid sequence (I/M) (H/Q/N) PF (L/F) HH

By means of polymerase chain reaction (PCR) with single-stranded C. purpureus cDNA, two DNA fragments 557 bp (Cer3) and 575 bp (Cer16) in length were amplified with primer A and primer C, and one DNA fragment 560 bp (Cer1) in length was amplified with primer B and primer C. The following program was used for the amplification: 10 minutes at 94.degree. C., pause for hot start at 72.degree. C., followed by 32 cycles of 20 s at 94.degree. C., 1 minute at 45.degree. C. (annealing temperature, T.sub.m) and 1 minute at 72.degree. C., 1 cycle of 10 minutes at 72.degree. C. and stop at 4.degree. C. The taq-DNA polymerase (Gibco BRL) was used for the amplification.

The abovementioned double-stranded DNA fragments from the two PCR amplifications were ligated into the pGEM-T vector (Promega), transformed into E. coli XL1blue MRF' Kan (Stratagene) and sequenced using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer, Weiterstadt). The Cer1 and Cer3 DNA subsequences showed 70% identity. The abovementioned DNA subsequences encoded open reading frames of 173 amino acids in the case of Cer1 (SEQ ID NO: 5=Partial nucleotide sequence of Cer1 without primer and SEQ ID NO: 6=Partial deduced amino acid sequence of Cer1), 172 amino acids in the case of Cer3 (SEQ ID NO: 7=Partial nucleotide sequence of Cer3 without primer and SEQ ID NO: 8=Partial deduced amino acid sequence of Cer3) and 178 amino acids in the case of Cer16 (SEQ ID NO: 9=Partial nucleotide sequence of Cer16 without primer and SEQ ID NO: 10=Partial deduced amino acid sequence of Cer16) without primers. The derived protein sequence of Cer1 showed an amino acid identity to Cer3 of 64% and to Cer16 of 28%; Cer3 and Cer16, in turn, had an amino acid identity of 27%.

The Cer1 and Cer3 proteins show the greatest similarity with the Physcomitrella patens .DELTA.6-acyl-lipid desaturase (Girke et al., Plant J., 15, 1998: 39 48), while Cer16 shows the greatest similarity to the .DELTA.6-acyl-lipid desaturase and the .DELTA.8-sphingolipid desaturase from higher plants.

A directed Ceratodon purpureus .lamda.ZAP cDNA library was provided by Fritz Thummler, Department of Botany, University of Munich (Pasentsis et al., Plant J., 13, 1, 1998: 51 61). This Ceratodon library was subjected to a PCR test, in which specific primers were derived from the abovementioned DNA subsequences Cer1, Cer3 and Cer 16:

Specific forward and reverse primers: Cer1: 5'-CGAATGAGTGCGACGAAC-3' (SEQ ID NO: 16)+5'-AATAACCTGGGCTCTCAC-3' (SEQ ID NO: 17) Cer3: 5'-ATGAGGATATTGATACTCTC-3' (SEQ ID NO: 18)+5'-GCAATCTGGGCATTCACG-3' (SEQ ID NO: 19) Cer16: 5'-GACATCAAAGCTCTTCTC-3' (SEQ ID NO: 20)+5'-GGCGATGAGAAGTGGTTC-3' (SEQ ID NO: 21)

A restriction analysis (HindIII and EcoRV) of the products amplified from the cDNA library by means of PCR showed the same restriction pattern in all three cases as that of the PCR amplificates from the ss-cDNA, i.e. the Ceratodon cDNA library contains the three clones Cer1, Cer3 and Cer16.

Example 7

cDNA Library Screening and Sequencing of the Full-length Clones

DNA minipreps in pGEM-T of the three .about.570 bp PCR fragments Cer1, Cer3, Cer16 amplified from ss-cDNA (see Example 6) were handed over to M. Lee and S. Stymne to subject the full-length clones from a Ceratodon purpureus .lamda.ZAP cDNA library to further screening. As yet, this cDNA library screening has provided two full-length clones of Cer1 and Cer3 with inserts of approx. 2.2 kb, which were subcloned as EcoRI/KpnI fragments from the .lamda.ZAP vector into the EcoRI/KpnI cleavage sites of the puc19 vector (New England Biolabs) and transformed into E. coli JM105. Further screening of the cDNA library with Cer1 and Cer3 as low-stringency hybridization probes revealed that at least one further clone with Cer1 homology exists which might conceivably encode the .DELTA..sup.5-desaturase.

Two E. coli clones, Cer1-50 and Cer3-50, were sequenced completely. Cer1-50 has a length of 2003 bp (SEQ ID NO: 1=nucleotide sequence of the .DELTA.6-acetylenase/.DELTA.6-desaturase from Ceratodon purpureus with 5' and 3' untranslated regions and polyA) and encodes an open reading frame of 483 amino acids (SEQ ID NO: 2=deduced amino acid sequence of the .DELTA.6-acetylenase/.DELTA.6-desaturase from Ceratodon purpureus). Cer3-50 has a length of 2142 bp (SEQ ID NO: 11 nucleotide sequence [2142 bp] of the .DELTA.6-desaturase from Ceratodon purpureus with 5' and 3' untranslated regions) with an open reading frame of 520 amino acids (SEQ ID NO: 12=deduced amino acid sequence of the .DELTA.6-desaturase from Ceratodon purpureus). Both protein sequences show the highly-conserved HPGG motif from cytochrome b.sub.5 at the N terminus (Lederer F., Biochimie 76, 1994: 674 692) and the three histidine boxes which are characteristic of desaturases at the C terminus (Shanklin et al., Biochemistry, 33, 1994: 12787 12794). Thus they constitute further members of the growing family of the cytochrome b.sub.5 fusion proteins (Napier et al., Trends in Plant Science, 4, 1, 1999: 2 4). The first histidine of the third box is exchanged for glutamine, another characteristic of .DELTA.5- and .DELTA.6-acyl-lipid desaturases and .DELTA.8-sphingolipid desaturases.

Example 8

Cloning of the complete functional active .DELTA.6-acetylenase/.DELTA.6-desaturase and .DELTA.6-desaturase sequence by PCR and provision of this sequence for cloning into vectors, and functional expression in yeast.

A cDNA which codes for enzymes with .DELTA.6-acetylenase/.DELTA.6-desaturase activity from Ceratodon purpureus was prepared. The .DELTA.6-desaturase was cloned in analogy to the example described herein (see SEQ ID NO: 2, SEQ ID NO: 4 and SEQ ID NO: 12).

This is done by initially deriving the oligonucleotides for a polymerase chain reaction (PCR) on the basis of the Cer1 cDNA for the .DELTA.6-acetylenase/desaturase from Ceratodon purpureus. Cer1: 5' - CC GGTACC ATG GCC CTC GTT ACC GAC - 3' (SEQ ID NO: 22)+5' - CC GAATTC TTA GTG AGC GTG AAG CCG - 3' (SEQ ID NO: 23) Cer3: 5' - CC GGTACC ATG GTG TCC CAG GGC GGC - 3' (SEQ ID NO: 24)+5' - CC GAATTC TCA ACT CGC AGC AAG CTG - 3' (SEQ ID NO: 25)

The following primers derived from Cer 1 were adapted for expression in yeast: 5' primer: 5' -AAAAGGATCCAAAATGGCCCTCGTTACCGAC - 3' (SEQ ID NO: 26) 3' primer: 5' -AAAAGTCGACTTAGTGAGCGTGAAGCC - 3' (SEQ ID NO: 27)

A .DELTA.6-acetylenase/desaturase cDNA from Ceratodon purpureus is used as template in a PCR. A BamHI restriction cleavage site is introduced with the aid of the primer in front of the start codon of the .DELTA.6-acetylenase/desaturase cDNA. For directed cloning, a SalI restriction cleavage site is introduced behind the stop codon. The reaction mixtures contained about 1 ng/microl template DNA, 0.5 microM oligonucleotides and 200 microM deoxynucleotides (Pharmacia), 50 mM KCl, 10 mM Tris-HCl (pH 8.3 at 25.degree. C., 1.5 mM MgCl.sub.2) and 0.02 U/microl Pwo polymerase (Boehringer Mannheim) and are incubated in a Perkin Elmer PCR machine with the following temperature program: Annealing temperature: 50.degree. C., 52 sec Denaturation temperature: 95.degree. C., 52 sec Elongation temperature: 72.degree. C., 90 sec Number of cycles: 30

The resulting fragment of 1467 base pairs is ligated into the vector pBluescript SK- (Stratagene) which has been cleaved with EcoRV. A clone is identified by control cleavage pBS-Cer1, whose insert can be excised in full length by BamHI/SalI (1452 base pairs plus 15 nucleotides of restriction cleavage sites) and has the following sequence (the start and stop codon is underlined, the cleavage sites are shown in italics). It is also possible analogously to use a cDNA sequence of the clone Cer50. This is a monofunctional delta-6-desaturase (see SEQ ID NO: 3). The derived amino acid sequence is to be found in SEQ ID NO: 4.

To check the functionality of the encoded enzyme in a microorganism, the 1467 bp BamHI/SalI fragment from pBS-Cer1 is ligated into the expression vector pYES2 (Invitrogen, Groningen, The Netherlands) which has been cut with BamHI/XhoI, and yeast is transformed by standard protocols with the newly produced plasmid pYES2-Cer1 (see Invitrogen transformation protocol, Groningen, The Netherlands). Resulting colonies are cultured on raffinose-containing medium, and .DELTA.6-acetylenase/desaturase gene expression is induced with galactose (see below).

Example 9

Lipid Analysis of Transformed Yeasts

Yeasts are capable of incorporating not only endogenous fatty acids (16:0, 16:1, 18:0 and 18:1) but also exogenous fatty acids into their membrane lipids. To test the substrate specificity of the particular desaturase expressed, the CM-2% raffinose medium is supplemented before the inoculation with 1% Tergitol NP-40 (w/v, Sigma) to solubilize exogenous fatty acids and 0.003% of the fatty acid in question (stock solution: 0.3% or 3% fatty acid in 5% Tergitol NP-40, w/v). The preculture was carried out by inoculating 3 ml CM-2% raffinose medium/1% Tergitol NP-40 with a transgenic yeast colony and subsequently incubating the culture in a rolling apparatus for 2 days at 30.degree. C. to an optical density at 600 nm (OD.sub.600) of 4.0 to 4.3. For the main culture, 10 ml of CM-2% raffinose/1% Tergitol NP-40 medium .+-.0.003% fatty acid are inoculated with an aliquot of the preculture (200-fold dilution) to an OD.sub.600 of 0.02 and incubated for 24 hours at 30.degree. C., 250 rpm, in a shaker. The test cultures were induced during the logarithmic growth phase (OD.sub.600 0.5 to 0.6) by adding galactose to 1.8%. After the induced cells had been grown aerobically for a further 24 hours at 30.degree. C., they were harvested at an OD.sub.600 of 4.0 to 4.3.

The induced yeast cells are harvested by centrifugation for 10 minutes at 2000 g, resuspended in 3 ml of distilled water, boiled for 10 minutes at 100.degree. C. and, after cooling on ice, resedimented. The cell sediment is hydrolyzed for 1 hour at 90.degree. C. using 1 N methanolic sulfuric acid and 2% dimethoxypropane, and the lipids were transmethylated. The resulting fatty acid methyl esters (FAMEs) are extracted with petroleum ether. The extracted FAMEs are analyzed by gas liquid chromatography using a capillary column (Chrompack, WCOT Fused Silica, CP-Wax-52 CB, 25 m, 0.32 mm) and a temperature gradient of 170.degree. C. to 240.degree. C. in 20 minutes and 5 minutes at 240.degree. C. The identity of the monoenoic, dienoic, trienoic and tetraenoic acid methyl esters is confirmed by comparison with suitable FAME standards (Sigma). No reference substances are available for the triynoic and tetraynoic acids. Their identity and the position of the triple bond are analyzed by means of GC-MS by subjecting the FAME mixtures to a suitable chemical derivatization, for example to give 4,4-dimethoxyoxazolin derivatives (Christie, 1998). The GC analyses of the fatty acid methyl esters from the transgenic yeasts which are transformed with the blank vector pYES2, with pYES2-Cer1 (.DELTA..sup.6-acetylenase) is shown in Table 1. The transgenic yeast cells are analyzed without exogenous fatty acids or after addition of linoleic acid (18:2), .gamma.-linolenic acid (.gamma.-18:3), .alpha.-linolenic acid (.alpha.-18:3) or .omega.3-octadecatetraenoic acid (18:4).

Table 1 shows the GC analyses of the fatty acid methyl esters from transgenic yeasts which had been transformed with the blank vector pYES2, the .DELTA.6-acetylenase (Cer1/pYES2) and the .DELTA.6-desaturase (Cer3/pYES2). The transgenic yeast cells were analyzed without exogenous fatty acids (-) or after addition of linoleic acid (18:2), .gamma.-linolenic acid (.gamma.-18:3), .alpha.-linolenic acid (.alpha.-18:3) or .omega.3-octadecatetraenoic acid (18:4). Fatty acid composition in [mol %] of the total fatty acids, the incorporation of the fed fatty acids (bold, in black), the desaturation products (in red) and the total of the desaturation products (last line) of the individual feeding experiments being indicated.

Example 10

Generation of Transgenic Plants which Overexpress an Enzyme with .DELTA.6-acetylenase/desaturase Activity

To transform plants, a transformation vector which ligates the BamHI/SalI fragment from pBS-Cer1 into the vector pBin-USP which has been cleaved with BamHI/SalI or into pBinAR is generated. pBin-USP and pBinAR are derivatives of the plasmid pBin19. pBinAR was produced from pBin19, by inserting a 35S CaMV promoter as EcoRI-KpnI fragment (corresponding to nucleotides 6909 7437 of cauliflower mosaic virus) (Franck et al. (1980) Cell 21, 285) into pBin19 (Bevan et al. (1980) Nucl. Acids Res. 12, 8711). The polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTiACH5 (Gielen et al., (1984) EMBO J. 3, 835), nucleotides 11749 11939, is isolated as PvuII-HindIII fragment and, after addition of SphI linkers to the PvuII cleavage site, cloned between the SphI-HindIII cleavage site of the vector. This resulted in the plasmid pBinAR (Hofgen and Willmitzer (1990) Plant Science 66, 221 230), there being, due to recloning from pBluescript, several restriction cleavage sites available between promoter and terminator. The USP promoter corresponds to nucleotides 1 684 (Genbank Accession X56240), with part of the noncoding region of the USP gene being present in the promoter. The promoter fragment which is 684 base pairs in size was amplified by a PCR by standard methods using commercially available T7 standard primers (Stratagene) and with the aid of a synthesized primer. (Primer sequence: 5'-GTCGACCCGCGGACTAGTGGGCCCTCTAGACCCGGGGGATCCGGATCTGCTGGCTATGAA - 3') (SEQ ID NO: 28).

The construct is employed for transforming Arabidopsis thaliana and oilseed rape plants.

Regenerated shoots are obtained on 2MS medium with kanamycin and Claforan and, after rooting, transferred into soil and, after cultivation for two weeks in an air-conditioned chamber or in a glasshouse, induced to flower, and ripe seeds are harvested and investigated for .DELTA.6-acetylenase/desaturase expression by lipid analyses. Lines with increased contents of acetylenic fatty acids or double bonds at the delta-6 position are identified. An increased content of acetylenic fatty acids and double bonds at the delta-6 position compared with untransformed control plants is found in the stably transformed transgenic lines which functionally express the transgene.

Example 11

Lipid Extraction from Seeds

The analysis of lipids from plant seeds takes place in analogy to the analysis of yeast lipids. However, plant material is first homogenized mechanically using mortars in order to make it available for extraction.

TABLE-US-00001 TABLE 1 Fatty acids pYES2 Cer1/pYES2 Cer3/pYES2 [mol %] -- 18:2 .gamma.-18:3 .alpha.-18:3 18:4 -- 18:2 .gamma.-18:3 .alpha- .-18.3 18:4 -- 18:2 .gamma.-18:3 .alpha.-18:3 18:4 16:0 26.2 24.1 27.8 27.4 32.7 24.2 23.1 26.2 25.7 26.5 26.5 23.3 28.1 29.2- 29.6 16:1.sup.9 41.8 9.6 27.4 27.3 16.1 36.5 13.3 24.7 28.8 21.9 43.8 9.9 25.2 - 34.0 20.9 16:2.sup.6,9 6.9 1.8 3.3 5.3 3.0 1.1 0.1 0.8 0.1 18:0 6.5 5.3 6.1 6.1 7.9 6.4 6.1 6.6 6.5 7.1 5.5 5.3 6.3 5.8 5.9 18:1.sup.9 23.6 4.9 15.1 14.8 11.3 24.9 8.8 15.6 20.0 16.8 21.4 5.3 15.7 1- 4.3 11.5 18:2.sup.6,9 0.3 0.2 0.3 0.2 0.1 0.1 18:2.sup.9,12 53.9 41.9 42.3 18:3.sup.6,9,12 19.5 0.8 16.1 8.1 21.2 18:3.sup.9,12,15 22.8 10.0 11.9 18:4.sup.6,9,12,15 28.8 1.7 21.3 1.9 30.1 18:3.sup.6yn,9,12 1.3 4.6 18:4.sup.6yn,9,12,15 2.3 .SIGMA. Des. [mol %] -- -- -- -- -- 7.2 3.9 8.1 7.3 5.5 1.2 8.1 0.1 2.8 0.1

SEQUENCE LISTINGS

1

2812040DNACeratodon purpureusCDS(176)..(1627) 1ctcaggcagg tctcagttga tgagacgctg agttctgaat cctttgagct gtgtcaggct 60cggcacttgt gggatggtga aggagtgatc gatcaggagt gcaggagctg cattagtttc 120tcagggtcga tcaggttatt ctgaaaaagg ctgcgtctgt gagcagtttg caaaa atg 178 Met 1gcc ctc gtt acc gac ttt ctg aac ttt ctg ggc acg aca tgg agc aag 226Ala Leu Val Thr Asp Phe Leu Asn Phe Leu Gly Thr Thr Trp Ser Lys 5 10 15tac agc gtg tac acc cat agc tat gct gga aac tat ggg cct act ttg 274Tyr Ser Val Tyr Thr His Ser Tyr Ala Gly Asn Tyr Gly Pro Thr Leu 20 25 30aag cac gcc aaa aag gtt tct gct caa ggt aaa act gcg gga cag aca 322Lys His Ala Lys Lys Val Ser Ala Gln Gly Lys Thr Ala Gly Gln Thr 35 40 45ctg aga cag aga tcg gtg cag gac aaa aag cca ggc act tac tct ctg 370Leu Arg Gln Arg Ser Val Gln Asp Lys Lys Pro Gly Thr Tyr Ser Leu 50 55 60 65gcc gat gtt gct tct cac gac agg cct gga gac tgc tgg atg atc gtc 418Ala Asp Val Ala Ser His Asp Arg Pro Gly Asp Cys Trp Met Ile Val 70 75 80aaa gag aag gtg tat gat att agc cgt ttt gcg gac gac cac cct gga 466Lys Glu Lys Val Tyr Asp Ile Ser Arg Phe Ala Asp Asp His Pro Gly 85 90 95ggg acg gta att agc acc tac ttt ggg cgg gat ggc aca gac gtt ttc 514Gly Thr Val Ile Ser Thr Tyr Phe Gly Arg Asp Gly Thr Asp Val Phe 100 105 110gca aca ttc cat cca cct gcc gca tgg aag caa ctc aat gac tac tac 562Ala Thr Phe His Pro Pro Ala Ala Trp Lys Gln Leu Asn Asp Tyr Tyr 115 120 125att gga gac ctt gct agg gaa gag ccc ctt gat gaa ttg ctt aaa gac 610Ile Gly Asp Leu Ala Arg Glu Glu Pro Leu Asp Glu Leu Leu Lys Asp130 135 140 145tac aga gat atg aga gcc gag ttt gtt aga gaa ggg ctt ttc aag agt 658Tyr Arg Asp Met Arg Ala Glu Phe Val Arg Glu Gly Leu Phe Lys Ser 150 155 160tcc aag gcc tgg ttc ctg ctt cag act ctg att aat gca gct ctc ttt 706Ser Lys Ala Trp Phe Leu Leu Gln Thr Leu Ile Asn Ala Ala Leu Phe 165 170 175gct gcg agc att gcg act atc tgt tac gac aag agt tac tgg gct att 754Ala Ala Ser Ile Ala Thr Ile Cys Tyr Asp Lys Ser Tyr Trp Ala Ile 180 185 190gtg ctg tca gcc agt ttg atg ggt ctc ttc gtc caa cag tgt gga tgg 802Val Leu Ser Ala Ser Leu Met Gly Leu Phe Val Gln Gln Cys Gly Trp 195 200 205ctt gcc cat gat ttc ctt cat caa cag gtc ttt gag aac cgt acc gcg 850Leu Ala His Asp Phe Leu His Gln Gln Val Phe Glu Asn Arg Thr Ala210 215 220 225aac tcc ttc ttt ggc tat ttg ttc ggc aat tgc gtg ctt ggc ttt agt 898Asn Ser Phe Phe Gly Tyr Leu Phe Gly Asn Cys Val Leu Gly Phe Ser 230 235 240gta tca tgg tgg agg acg aag cac aac att cat cat act gct ccg aat 946Val Ser Trp Trp Arg Thr Lys His Asn Ile His His Thr Ala Pro Asn 245 250 255gag tgc gac gaa cag tac aca cct cta gac gaa gac att gat act ctc 994Glu Cys Asp Glu Gln Tyr Thr Pro Leu Asp Glu Asp Ile Asp Thr Leu 260 265 270ccc atc att gcc tgg agc aag gaa att ttg gcc acc gtt gag agc aag 1042Pro Ile Ile Ala Trp Ser Lys Glu Ile Leu Ala Thr Val Glu Ser Lys 275 280 285aga att ttg cga gtg ctt caa tat cag cac tac atg att ctg cct cta 1090Arg Ile Leu Arg Val Leu Gln Tyr Gln His Tyr Met Ile Leu Pro Leu290 295 300 305ttg ttc atg gcc cgg tac agt tgg act ttt gga agt ttg ctc ttc aca 1138Leu Phe Met Ala Arg Tyr Ser Trp Thr Phe Gly Ser Leu Leu Phe Thr 310 315 320ttc aat cct gat ttg agc acg acc aag gga ttg ata gag aag gga aca 1186Phe Asn Pro Asp Leu Ser Thr Thr Lys Gly Leu Ile Glu Lys Gly Thr 325 330 335gtt gct ttt cac tac gcc tgg ttc agt tgg gct gcg ttc cat att ttg 1234Val Ala Phe His Tyr Ala Trp Phe Ser Trp Ala Ala Phe His Ile Leu 340 345 350ccg ggt gtc gct aag cct ctt gcg tgg atg gta gca act gag ctt gtg 1282Pro Gly Val Ala Lys Pro Leu Ala Trp Met Val Ala Thr Glu Leu Val 355 360 365gcc ggt ttg ttg ttg gga ttc gtg ttt acg ttg agt cac aat gga aag 1330Ala Gly Leu Leu Leu Gly Phe Val Phe Thr Leu Ser His Asn Gly Lys370 375 380 385gag gtt tac aat gaa tcg aag gac ttc gtg aga gcc cag gtt att acc 1378Glu Val Tyr Asn Glu Ser Lys Asp Phe Val Arg Ala Gln Val Ile Thr 390 395 400acc cgt aac acc aag cga ggc tgg ttc aac gat tgg ttc act ggg gga 1426Thr Arg Asn Thr Lys Arg Gly Trp Phe Asn Asp Trp Phe Thr Gly Gly 405 410 415ctc gac acc cag att gag cat cac ctg ttt cca aca atg ccc agg cac 1474Leu Asp Thr Gln Ile Glu His His Leu Phe Pro Thr Met Pro Arg His 420 425 430aac tac ccc aag atc gca cct cag gtc gag gct ctt tgc aag aag cac 1522Asn Tyr Pro Lys Ile Ala Pro Gln Val Glu Ala Leu Cys Lys Lys His 435 440 445ggc ctc gag tac gat aat gtc tcc gtc gtt ggt gcc tct gtc gcg gtt 1570Gly Leu Glu Tyr Asp Asn Val Ser Val Val Gly Ala Ser Val Ala Val450 455 460 465gtg aag gcg ctc aag gaa att gct gat gaa gcg tca att cgg ctt cac 1618Val Lys Ala Leu Lys Glu Ile Ala Asp Glu Ala Ser Ile Arg Leu His 470 475 480gct cac taa gaaatcgtcg aactttgact attcattttt ttcgcctggc 1667Ala Histacctcaaat gttcgggagc aggtgcttgg cagtgtgttc aaccggagcg cactgaaaat 1727gtgcagaatc catttccaga aattaccatt cctagctaaa tcttcttttt accaggtcgg 1787atatatgaaa cttttttgat gcaacaagta gcattcaatt gaagacattg ttcgagatat 1847aattcgcagt gtttctattc agcgggcata cgtactagtc catatcggcg gttgccgaga 1907gtttacatta ttagttggca caacgagtag atctagtgta aatttctatt tccgcatgta 1967atattactct gaatatatac cgttatctat tttcctaaaa aaaaaaaaaa aaaaaaaaaa 2027aaaaaaaaaa aaa 20402483PRTCeratodon purpureus 2Met Ala Leu Val Thr Asp Phe Leu Asn Phe Leu Gly Thr Thr Trp Ser 1 5 10 15Lys Tyr Ser Val Tyr Thr His Ser Tyr Ala Gly Asn Tyr Gly Pro Thr 20 25 30Leu Lys His Ala Lys Lys Val Ser Ala Gln Gly Lys Thr Ala Gly Gln 35 40 45Thr Leu Arg Gln Arg Ser Val Gln Asp Lys Lys Pro Gly Thr Tyr Ser 50 55 60Leu Ala Asp Val Ala Ser His Asp Arg Pro Gly Asp Cys Trp Met Ile 65 70 75 80Val Lys Glu Lys Val Tyr Asp Ile Ser Arg Phe Ala Asp Asp His Pro 85 90 95Gly Gly Thr Val Ile Ser Thr Tyr Phe Gly Arg Asp Gly Thr Asp Val 100 105 110Phe Ala Thr Phe His Pro Pro Ala Ala Trp Lys Gln Leu Asn Asp Tyr 115 120 125Tyr Ile Gly Asp Leu Ala Arg Glu Glu Pro Leu Asp Glu Leu Leu Lys 130 135 140Asp Tyr Arg Asp Met Arg Ala Glu Phe Val Arg Glu Gly Leu Phe Lys145 150 155 160Ser Ser Lys Ala Trp Phe Leu Leu Gln Thr Leu Ile Asn Ala Ala Leu 165 170 175Phe Ala Ala Ser Ile Ala Thr Ile Cys Tyr Asp Lys Ser Tyr Trp Ala 180 185 190Ile Val Leu Ser Ala Ser Leu Met Gly Leu Phe Val Gln Gln Cys Gly 195 200 205Trp Leu Ala His Asp Phe Leu His Gln Gln Val Phe Glu Asn Arg Thr 210 215 220Ala Asn Ser Phe Phe Gly Tyr Leu Phe Gly Asn Cys Val Leu Gly Phe225 230 235 240Ser Val Ser Trp Trp Arg Thr Lys His Asn Ile His His Thr Ala Pro 245 250 255Asn Glu Cys Asp Glu Gln Tyr Thr Pro Leu Asp Glu Asp Ile Asp Thr 260 265 270Leu Pro Ile Ile Ala Trp Ser Lys Glu Ile Leu Ala Thr Val Glu Ser 275 280 285Lys Arg Ile Leu Arg Val Leu Gln Tyr Gln His Tyr Met Ile Leu Pro 290 295 300Leu Leu Phe Met Ala Arg Tyr Ser Trp Thr Phe Gly Ser Leu Leu Phe305 310 315 320Thr Phe Asn Pro Asp Leu Ser Thr Thr Lys Gly Leu Ile Glu Lys Gly 325 330 335Thr Val Ala Phe His Tyr Ala Trp Phe Ser Trp Ala Ala Phe His Ile 340 345 350Leu Pro Gly Val Ala Lys Pro Leu Ala Trp Met Val Ala Thr Glu Leu 355 360 365Val Ala Gly Leu Leu Leu Gly Phe Val Phe Thr Leu Ser His Asn Gly 370 375 380Lys Glu Val Tyr Asn Glu Ser Lys Asp Phe Val Arg Ala Gln Val Ile385 390 395 400Thr Thr Arg Asn Thr Lys Arg Gly Trp Phe Asn Asp Trp Phe Thr Gly 405 410 415Gly Leu Asp Thr Gln Ile Glu His His Leu Phe Pro Thr Met Pro Arg 420 425 430His Asn Tyr Pro Lys Ile Ala Pro Gln Val Glu Ala Leu Cys Lys Lys 435 440 445His Gly Leu Glu Tyr Asp Asn Val Ser Val Val Gly Ala Ser Val Ala 450 455 460Val Val Lys Ala Leu Lys Glu Ile Ala Asp Glu Ala Ser Ile Arg Leu465 470 475 480His Ala His31467DNACeratodon purpureusCDS(10)..(1461) 3ggatccaaa atg gcc ctc gtt acc gac ttt ctg aac ttt ctg ggc acg aca 51 Met Ala Leu Val Thr Asp Phe Leu Asn Phe Leu Gly Thr Thr 1 5 10tgg agc aag tac agc gtg tac acc cat agc tat gct gga aac tat ggg 99Trp Ser Lys Tyr Ser Val Tyr Thr His Ser Tyr Ala Gly Asn Tyr Gly 15 20 25 30cct act ttg aag cac gcc aaa aag gtt tct gct caa ggt aaa act gcg 147Pro Thr Leu Lys His Ala Lys Lys Val Ser Ala Gln Gly Lys Thr Ala 35 40 45gga cag aca ctg aga cag aga tcg gtg cag gac aaa aag cca ggc act 195Gly Gln Thr Leu Arg Gln Arg Ser Val Gln Asp Lys Lys Pro Gly Thr 50 55 60tac tct ctg gcc gat gtt gct tct cac gac agg cct gga gac tgc tgg 243Tyr Ser Leu Ala Asp Val Ala Ser His Asp Arg Pro Gly Asp Cys Trp 65 70 75atg atc gtc aaa gag aag gtg tat gat att agc cgt ttt gcg gac gac 291Met Ile Val Lys Glu Lys Val Tyr Asp Ile Ser Arg Phe Ala Asp Asp 80 85 90cac cct gga ggg acg gta att agc acc tac ttt ggg cgg gat ggc aca 339His Pro Gly Gly Thr Val Ile Ser Thr Tyr Phe Gly Arg Asp Gly Thr 95 100 105 110gac gtt ttc gca aca ttc cat cca cct gcc gca tgg aag caa ctc aat 387Asp Val Phe Ala Thr Phe His Pro Pro Ala Ala Trp Lys Gln Leu Asn 115 120 125gac tac tac att gga gac ctt gct agg gaa gag ccc ctt gat gaa ttg 435Asp Tyr Tyr Ile Gly Asp Leu Ala Arg Glu Glu Pro Leu Asp Glu Leu 130 135 140ctt aaa gac tac aga gat atg aga gcc gag ttt gtt aga gaa ggg ctt 483Leu Lys Asp Tyr Arg Asp Met Arg Ala Glu Phe Val Arg Glu Gly Leu 145 150 155ttc aag agt tcc aag gcc tgg ttc ctg ctt cag act ctg att aat gca 531Phe Lys Ser Ser Lys Ala Trp Phe Leu Leu Gln Thr Leu Ile Asn Ala 160 165 170gct ctc ttt gct gcg agc att gcg act atc tgt tac gac aag agt tac 579Ala Leu Phe Ala Ala Ser Ile Ala Thr Ile Cys Tyr Asp Lys Ser Tyr175 180 185 190tgg gct att gtg ctg tca gcc agt ttg atg ggt ctc ttc gtc caa cag 627Trp Ala Ile Val Leu Ser Ala Ser Leu Met Gly Leu Phe Val Gln Gln 195 200 205tgt gga tgg ctt gcc cat gat ttc ctt cat caa cag gtc ttt gag aac 675Cys Gly Trp Leu Ala His Asp Phe Leu His Gln Gln Val Phe Glu Asn 210 215 220cgt acc gcg aac tcc ttc ttt ggc tat ttg ttc ggc aat tgc gtg ctt 723Arg Thr Ala Asn Ser Phe Phe Gly Tyr Leu Phe Gly Asn Cys Val Leu 225 230 235ggc ttt agt gta tca tgg tgg agg acg aag cac aac att cat cat act 771Gly Phe Ser Val Ser Trp Trp Arg Thr Lys His Asn Ile His His Thr 240 245 250gct ccg aat gag tgc gac gaa cag tac aca cct cta gac gaa gac att 819Ala Pro Asn Glu Cys Asp Glu Gln Tyr Thr Pro Leu Asp Glu Asp Ile255 260 265 270gat act ctc ccc atc att gcc tgg agc aag gaa att ttg gcc acc gtt 867Asp Thr Leu Pro Ile Ile Ala Trp Ser Lys Glu Ile Leu Ala Thr Val 275 280 285gag agc aag aga att ttg cga gtg ctt caa tat cag cac tac atg att 915Glu Ser Lys Arg Ile Leu Arg Val Leu Gln Tyr Gln His Tyr Met Ile 290 295 300ctg cct cta ttg ttc atg gcc cgg tac agt tgg act ttt gga agt ttg 963Leu Pro Leu Leu Phe Met Ala Arg Tyr Ser Trp Thr Phe Gly Ser Leu 305 310 315ctc ttc aca ttc aat cct gat ttg agc acg acc aag gga ttg ata gag 1011Leu Phe Thr Phe Asn Pro Asp Leu Ser Thr Thr Lys Gly Leu Ile Glu 320 325 330aag gga aca gtt gct ttt cac tac gcc tgg ttc agt tgg gct gcg ttc 1059Lys Gly Thr Val Ala Phe His Tyr Ala Trp Phe Ser Trp Ala Ala Phe335 340 345 350cat att ttg ccg ggt gtc gct aag cct ctt gcg tgg atg gta gca act 1107His Ile Leu Pro Gly Val Ala Lys Pro Leu Ala Trp Met Val Ala Thr 355 360 365gag ctt gtg gcc ggt ttg ttg ttg gga ttc gtg ttt acg ttg agt cac 1155Glu Leu Val Ala Gly Leu Leu Leu Gly Phe Val Phe Thr Leu Ser His 370 375 380aat gga aag gag gtt tac aat gaa tcg aag gac ttc gtg aga gcc cag 1203Asn Gly Lys Glu Val Tyr Asn Glu Ser Lys Asp Phe Val Arg Ala Gln 385 390 395gtt att acc acc cgt aac acc aag cga ggc tgg ttc aac gat tgg ttc 1251Val Ile Thr Thr Arg Asn Thr Lys Arg Gly Trp Phe Asn Asp Trp Phe 400 405 410act ggg gga ctc gac acc cag att gag cat cac ctg ttt cca aca atg 1299Thr Gly Gly Leu Asp Thr Gln Ile Glu His His Leu Phe Pro Thr Met415 420 425 430ccc agg cac aac tac ccc aag atc gca cct cag gtc gag gct ctt tgc 1347Pro Arg His Asn Tyr Pro Lys Ile Ala Pro Gln Val Glu Ala Leu Cys 435 440 445aag aag cac ggc ctc gag tac gat aat gtc tcc gtc gtt ggt gcc tct 1395Lys Lys His Gly Leu Glu Tyr Asp Asn Val Ser Val Val Gly Ala Ser 450 455 460gtc gcg gtt gtg aag gcg ctc aag gaa att gct gat gaa gcg tca att 1443Val Ala Val Val Lys Ala Leu Lys Glu Ile Ala Asp Glu Ala Ser Ile 465 470 475cgg ctt cac gct cac taa gtcgac 1467Arg Leu His Ala His 4804483PRTCeratodon purpureus 4Met Ala Leu Val Thr Asp Phe Leu Asn Phe Leu Gly Thr Thr Trp Ser 1 5 10 15Lys Tyr Ser Val Tyr Thr His Ser Tyr Ala Gly Asn Tyr Gly Pro Thr 20 25 30Leu Lys His Ala Lys Lys Val Ser Ala Gln Gly Lys Thr Ala Gly Gln 35 40 45Thr Leu Arg Gln Arg Ser Val Gln Asp Lys Lys Pro Gly Thr Tyr Ser 50 55 60Leu Ala Asp Val Ala Ser His Asp Arg Pro Gly Asp Cys Trp Met Ile 65 70 75 80Val Lys Glu Lys Val Tyr Asp Ile Ser Arg Phe Ala Asp Asp His Pro 85 90 95Gly Gly Thr Val Ile Ser Thr Tyr Phe Gly Arg Asp Gly Thr Asp Val 100 105 110Phe Ala Thr Phe His Pro Pro Ala Ala Trp Lys Gln Leu Asn Asp Tyr 115 120 125Tyr Ile Gly Asp Leu Ala Arg Glu Glu Pro Leu Asp Glu Leu Leu Lys 130 135 140Asp Tyr Arg Asp Met Arg Ala Glu Phe Val Arg Glu Gly Leu Phe Lys145 150 155 160Ser Ser Lys Ala Trp Phe Leu Leu Gln Thr Leu Ile Asn Ala Ala Leu 165 170 175Phe Ala Ala Ser Ile Ala Thr Ile Cys Tyr Asp Lys Ser Tyr Trp Ala 180 185 190Ile Val Leu Ser Ala Ser Leu Met Gly Leu Phe Val Gln Gln Cys Gly 195 200 205Trp Leu Ala His Asp Phe Leu His Gln Gln Val Phe Glu Asn Arg Thr 210 215 220Ala Asn Ser Phe Phe Gly Tyr Leu Phe Gly Asn Cys Val Leu Gly Phe225 230 235 240Ser Val Ser Trp Trp Arg Thr Lys His Asn Ile His His Thr Ala Pro 245 250 255Asn Glu Cys Asp Glu Gln Tyr Thr Pro Leu Asp Glu Asp Ile Asp Thr 260 265 270Leu Pro Ile Ile Ala Trp Ser Lys Glu Ile Leu Ala Thr Val Glu Ser 275 280 285Lys Arg Ile Leu

Arg Val Leu Gln Tyr Gln His Tyr Met Ile Leu Pro 290 295 300Leu Leu Phe Met Ala Arg Tyr Ser Trp Thr Phe Gly Ser Leu Leu Phe305 310 315 320Thr Phe Asn Pro Asp Leu Ser Thr Thr Lys Gly Leu Ile Glu Lys Gly 325 330 335Thr Val Ala Phe His Tyr Ala Trp Phe Ser Trp Ala Ala Phe His Ile 340 345 350Leu Pro Gly Val Ala Lys Pro Leu Ala Trp Met Val Ala Thr Glu Leu 355 360 365Val Ala Gly Leu Leu Leu Gly Phe Val Phe Thr Leu Ser His Asn Gly 370 375 380Lys Glu Val Tyr Asn Glu Ser Lys Asp Phe Val Arg Ala Gln Val Ile385 390 395 400Thr Thr Arg Asn Thr Lys Arg Gly Trp Phe Asn Asp Trp Phe Thr Gly 405 410 415Gly Leu Asp Thr Gln Ile Glu His His Leu Phe Pro Thr Met Pro Arg 420 425 430His Asn Tyr Pro Lys Ile Ala Pro Gln Val Glu Ala Leu Cys Lys Lys 435 440 445His Gly Leu Glu Tyr Asp Asn Val Ser Val Val Gly Ala Ser Val Ala 450 455 460Val Val Lys Ala Leu Lys Glu Ile Ala Asp Glu Ala Ser Ile Arg Leu465 470 475 480His Ala His5520DNACeratodon purpureus 5cattcatcat actgctccga atgagtgcga cgaacagtac acacctctag acgaagacat 60tgatactctc cccatcattg cctggagcaa ggaaattttg gccaccgttg agagcaagag 120aattttgcga gtgcttcgat atcagcacta catgattctg cctctattgt tcatggcccg 180gtacagttgg acttttggaa gtttgctctt cacattcaat cctgatttga gcacgaccaa 240gggattgata gagaagggaa cagttgcttt tcactacgcc tggttcagtt gggctgcgtt 300ccatattttg ccgggtgtcg ctaagcctct tgcgtggatg gtagcaactg agcttgtggc 360cggtttgttg ttgggattcg tgtttacgtt gagtcacaat ggaaaggagg tttacaatga 420atcgaaggac ttcgtgagag cccaggttat taccacccgt aacaccaagc gaggctggtt 480caacgattgg ttcactgggg gactcgacac ccagattgag 5206173PRTCeratodon purpureus 6Ile His His Thr Ala Pro Asn Glu Cys Asp Glu Gln Tyr Thr Pro Leu 1 5 10 15Asp Glu Asp Ile Asp Thr Leu Pro Ile Ile Ala Trp Ser Lys Glu Ile 20 25 30Leu Ala Thr Val Glu Ser Lys Arg Ile Leu Arg Val Leu Gln Tyr Gln 35 40 45His Tyr Met Ile Leu Pro Leu Leu Phe Met Ala Arg Tyr Ser Trp Thr 50 55 60Phe Gly Ser Leu Leu Phe Thr Phe Asn Pro Asp Leu Ser Thr Thr Lys 65 70 75 80Gly Leu Ile Glu Lys Gly Thr Val Ala Phe His Tyr Ala Trp Phe Ser 85 90 95Trp Ala Ala Phe His Ile Leu Pro Gly Val Ala Lys Pro Leu Ala Trp 100 105 110Met Val Ala Thr Glu Leu Val Ala Gly Leu Leu Leu Gly Phe Val Phe 115 120 125Thr Leu Ser His Asn Gly Lys Glu Val Tyr Asn Glu Ser Lys Asp Phe 130 135 140Val Arg Ala Gln Val Ile Thr Thr Arg Asn Thr Lys Arg Gly Trp Phe145 150 155 160Asn Asp Trp Phe Thr Gly Gly Leu Asp Thr Gln Ile Glu 165 1707514DNACeratodon purpureus 7cctgcatcat gctgctccga atgaatgcga ccaaaagtac acgccgattg atgaggatat 60tgatactctc cccatcattg cttggagtaa agatctcttg gccactgttg agagcaagac 120catgttgcga gttcttcagt accagcacct attctttttg gttcttttga cgtttgcccg 180ggcgagttgg ctattttgga gcgcggcctt cactctcagg cccgagttga cccttggcga 240gaagcttttg gagaggggaa cgatggcttt gcactacatt tggtttaata gtgttgcgtt 300ttatctgctc cccggatgga aaccagttgt atggatggtg gtcagcgagc tcatgtctgg 360tttcctgctg ggatacgtat ttgtactcag tcacaatgga atggaggtgt acaatacgtc 420aaaggacttc gtgaatgccc agattgcatc gactcgcgac atcaaagcag gggtgtttaa 480tgattggttc accggaggtc tcaacagaca gatt 5148172PRTCeratodon purpureus 8Leu His His Ala Ala Pro Asn Glu Cys Asp Gln Lys Tyr Thr Pro Ile 1 5 10 15Asp Glu Asp Ile Asp Thr Leu Pro Ile Ile Ala Trp Ser Lys Asp Leu 20 25 30Leu Ala Thr Val Glu Ser Lys Thr Met Leu Arg Val Leu Gln Tyr Gln 35 40 45His Leu Phe Phe Leu Val Leu Leu Thr Phe Ala Arg Ala Ser Trp Leu 50 55 60Phe Trp Ser Ala Ala Phe Thr Leu Arg Pro Glu Leu Thr Leu Gly Glu 65 70 75 80Lys Leu Leu Glu Arg Gly Thr Met Ala Leu His Tyr Ile Trp Phe Asn 85 90 95Ser Val Ala Phe Tyr Leu Leu Pro Gly Trp Lys Pro Val Val Trp Met 100 105 110Val Val Ser Glu Leu Met Ser Gly Phe Leu Leu Gly Tyr Val Phe Val 115 120 125Leu Ser His Asn Gly Met Glu Val Tyr Asn Thr Ser Lys Asp Phe Val 130 135 140Asn Ala Gln Ile Ala Ser Thr Arg Asp Ile Lys Ala Gly Val Phe Asn145 150 155 160Asp Trp Phe Thr Gly Gly Leu Asn Arg Gln Ile Glu 165 1709535DNACeratodon purpureus 9tgctcatcac atcgcctgta atagtataga atatgatcca gacctacagt acatccccct 60ttttgcagtg acatcaaagc tcttctctaa cctctactcc tacttctatg aaagggttat 120gccattcgat ggcgtagcac gctctctgat tgcctaccag cactggacgt tttatccaat 180aatggctgtt gctcgggtga acctctttgc ccaatccctt ctagtactga cctcgaagaa 240gcatgtgcca gacaggtggc ttgagctcgg tgctatcggt ttcttctacc tgtggttctt 300caccctcttg tcgtacctgc ccactgcacc ggagaggctt gctttcgtcc ttgtcagttt 360tgcagtgaca gggatccagc atgtacagtt ttgcctgaac cacttctcat cgccggttta 420tctaggacag ccgaagagca aggcttgggt tgaatctcaa gcacggggca ctctcaatct 480ctctacaccg gcttacatgg attggtttca cgggggtctt cagttccaga tcgag 53510178PRTCeratodon purpureus 10Ala His His Ile Ala Cys Asn Ser Ile Glu Tyr Asp Pro Asp Leu Gln 1 5 10 15Tyr Ile Pro Leu Phe Ala Val Thr Ser Lys Leu Phe Ser Asn Leu Tyr 20 25 30Ser Tyr Phe Tyr Glu Arg Val Met Pro Phe Asp Gly Val Ala Arg Ser 35 40 45Leu Ile Ala Tyr Gln His Trp Thr Phe Tyr Pro Ile Met Ala Val Ala 50 55 60Arg Val Asn Leu Phe Ala Gln Ser Leu Leu Val Leu Thr Ser Lys Lys 65 70 75 80His Val Pro Asp Arg Trp Leu Glu Leu Gly Ala Ile Gly Phe Phe Tyr 85 90 95Leu Trp Phe Phe Thr Leu Leu Ser Tyr Leu Pro Thr Ala Pro Glu Arg 100 105 110Leu Ala Phe Val Leu Val Ser Phe Ala Val Thr Gly Ile Gln His Val 115 120 125Gln Phe Cys Leu Asn His Phe Ser Ser Pro Val Tyr Leu Gly Gln Pro 130 135 140Lys Ser Lys Ala Trp Val Glu Ser Gln Ala Arg Gly Thr Leu Asn Leu145 150 155 160Ser Thr Pro Ala Tyr Met Asp Trp Phe His Gly Gly Leu Gln Phe Gln 165 170 175Ile Glu112160DNACeratodon purpureusCDS(159)..(1721) 11cggaggtctc ttgtcgttct tggagtctgt gtcgagcttg gaatgcggta ggcgcggccg 60tttcgtggtt ttggcgttgg cattgcgcga gggcggacag tgggagtgcg ggaggtctgt 120ttgtgcatga cgaggtggtt gtaatcttcg ccggcaga atg gtg tcc cag ggc ggc 176 Met Val Ser Gln Gly Gly 1 5ggt ctc tcg cag ggt tcc att gaa gaa aac att gac gtt gag cac ttg 224Gly Leu Ser Gln Gly Ser Ile Glu Glu Asn Ile Asp Val Glu His Leu 10 15 20gca acg atg ccc ctc gtc agt gac ttc cta aat gtc ctg gga acg act 272Ala Thr Met Pro Leu Val Ser Asp Phe Leu Asn Val Leu Gly Thr Thr 25 30 35ttg ggc cag tgg agt ctt tcc act aca ttc gct ttc aag agg ctc acg 320Leu Gly Gln Trp Ser Leu Ser Thr Thr Phe Ala Phe Lys Arg Leu Thr 40 45 50act aag aaa cac agt tcg gac atc tcg gtg gag gca caa aaa gaa tcg 368Thr Lys Lys His Ser Ser Asp Ile Ser Val Glu Ala Gln Lys Glu Ser 55 60 65 70gtt gcg cgg ggg cca gtt gag aat att tct caa tcg gtt gcg cag ccc 416Val Ala Arg Gly Pro Val Glu Asn Ile Ser Gln Ser Val Ala Gln Pro 75 80 85atc agg cgg agg tgg gtg cag gat aaa aag ccg gtt act tac agc ctg 464Ile Arg Arg Arg Trp Val Gln Asp Lys Lys Pro Val Thr Tyr Ser Leu 90 95 100aag gat gta gct tcg cac gat atg ccc cag gac tgc tgg att ata atc 512Lys Asp Val Ala Ser His Asp Met Pro Gln Asp Cys Trp Ile Ile Ile 105 110 115aaa gag aag gtg tat gat gtg agc acc ttc gct gag cag cac cct gga 560Lys Glu Lys Val Tyr Asp Val Ser Thr Phe Ala Glu Gln His Pro Gly 120 125 130ggc acg gtt atc aac acc tac ttc gga cga gac gcc aca gat gtt ttc 608Gly Thr Val Ile Asn Thr Tyr Phe Gly Arg Asp Ala Thr Asp Val Phe135 140 145 150tct act ttc cac gca tcc acc tca tgg aag att ctt cag aat ttc tac 656Ser Thr Phe His Ala Ser Thr Ser Trp Lys Ile Leu Gln Asn Phe Tyr 155 160 165atc ggg aac ctt gtt agg gag gag ccg act ttg gag ctg ctg aag gag 704Ile Gly Asn Leu Val Arg Glu Glu Pro Thr Leu Glu Leu Leu Lys Glu 170 175 180tac aga gag ttg aga gcc ctt ttc ttg aga gaa cag ctt ttc aag agt 752Tyr Arg Glu Leu Arg Ala Leu Phe Leu Arg Glu Gln Leu Phe Lys Ser 185 190 195tcc aaa tcc tac tac ctt ttc aag act ctc ata aat gtt tcc att gtt 800Ser Lys Ser Tyr Tyr Leu Phe Lys Thr Leu Ile Asn Val Ser Ile Val 200 205 210gcc aca agc att gcg ata atc agt ctg tac aag tct tac cgg gcg gtt 848Ala Thr Ser Ile Ala Ile Ile Ser Leu Tyr Lys Ser Tyr Arg Ala Val215 220 225 230ctg tta tca gcc agt ttg atg ggc ttg ttt att caa cag tgc gga tgg 896Leu Leu Ser Ala Ser Leu Met Gly Leu Phe Ile Gln Gln Cys Gly Trp 235 240 245ttg tct cac gat ttt cta cac cat cag gta ttt gag aca cgc tgg ctc 944Leu Ser His Asp Phe Leu His His Gln Val Phe Glu Thr Arg Trp Leu 250 255 260aat gac gtt gtt ggc tat gtg gtc ggc aac gtt gtt ctg gga ttc agt 992Asn Asp Val Val Gly Tyr Val Val Gly Asn Val Val Leu Gly Phe Ser 265 270 275gtc tcg tgg tgg aag acc aag cac aac ctg cat cat gct gct ccg aat 1040Val Ser Trp Trp Lys Thr Lys His Asn Leu His His Ala Ala Pro Asn 280 285 290gaa tgc gac caa aag tac aca ccg att gat gag gat att gat act ctc 1088Glu Cys Asp Gln Lys Tyr Thr Pro Ile Asp Glu Asp Ile Asp Thr Leu295 300 305 310ccc atc att gct tgg agt aaa gat ctc ttg gcc act gtt gag agc aag 1136Pro Ile Ile Ala Trp Ser Lys Asp Leu Leu Ala Thr Val Glu Ser Lys 315 320 325acc atg ttg cga gtt ctt cag tac cag cac cta ttc ttt ttg gtt ctt 1184Thr Met Leu Arg Val Leu Gln Tyr Gln His Leu Phe Phe Leu Val Leu 330 335 340ttg acg ttt gcc cgg gcg agt tgg cta ttt tgg agc gcg gcc ttc act 1232Leu Thr Phe Ala Arg Ala Ser Trp Leu Phe Trp Ser Ala Ala Phe Thr 345 350 355ctc agg ccc gag ttg acc ctt ggc gag aag ctt ttg gag agg gga acg 1280Leu Arg Pro Glu Leu Thr Leu Gly Glu Lys Leu Leu Glu Arg Gly Thr 360 365 370atg gct ttg cac tac att tgg ttt aat agt gtt gcg ttt tat ctg ctc 1328Met Ala Leu His Tyr Ile Trp Phe Asn Ser Val Ala Phe Tyr Leu Leu375 380 385 390ccc gga tgg aaa cca gtt gta tgg atg gtg gtc agc gag ctc atg tct 1376Pro Gly Trp Lys Pro Val Val Trp Met Val Val Ser Glu Leu Met Ser 395 400 405ggt ttc ctg ctg gga tac gta ttt gta ctc agt cac aat gga atg gag 1424Gly Phe Leu Leu Gly Tyr Val Phe Val Leu Ser His Asn Gly Met Glu 410 415 420gtg tac aat acg tca aag gac ttc gtg aat gcc cag att gca tcg act 1472Val Tyr Asn Thr Ser Lys Asp Phe Val Asn Ala Gln Ile Ala Ser Thr 425 430 435cgc gac atc aaa gca ggg gtg ttt aat gat tgg ttc acc gga ggt ctc 1520Arg Asp Ile Lys Ala Gly Val Phe Asn Asp Trp Phe Thr Gly Gly Leu 440 445 450aac aga cag att gag cat cat cta ttt cca acg atg ccc agg cac aac 1568Asn Arg Gln Ile Glu His His Leu Phe Pro Thr Met Pro Arg His Asn455 460 465 470ctt aat aaa att tct cct cac gtg gag act ttg tgc aag aag cat gga 1616Leu Asn Lys Ile Ser Pro His Val Glu Thr Leu Cys Lys Lys His Gly 475 480 485ctg gtc tac gaa gac gtg agc atg gct tcg ggc act tac cgg gtt ttg 1664Leu Val Tyr Glu Asp Val Ser Met Ala Ser Gly Thr Tyr Arg Val Leu 490 495 500aaa aca ctt aag gac gtt gcc gat gct gct tca cac cag cag ctt gct 1712Lys Thr Leu Lys Asp Val Ala Asp Ala Ala Ser His Gln Gln Leu Ala 505 510 515gcg agt tga ggcatcgcag cactcgtcga aacatttttg tctgttatag 1761Ala Ser 520tgttcatatg tgatcgaggg gaaaaggtcc catgctctga tctattcttc tgtagccaat 1821atttttcaat tgaaaggagg ttcctcactt atcttccatc tatcgttgca catcctgcat 1881cagagttagc gttggagtaa tgttaagcac ttgtagatta tgcccaccat tgccacattt 1941ctgttcggtt acaatcgttt gattccatgc tatcctccgt gttcatctcg ttgttataag 2001caagcttgaa aaaacatgct acgagattgg cagacgttgt cttggcagct gtagaggttg 2061gttccattca ttgtgtagta cagaactctc tcgtccctgt ttctctacat tacttgttac 2121atagtgactt tcattcacag caaaaaaaaa aaaaaaaaa 216012520PRTCeratodon purpureus 12Met Val Ser Gln Gly Gly Gly Leu Ser Gln Gly Ser Ile Glu Glu Asn 1 5 10 15Ile Asp Val Glu His Leu Ala Thr Met Pro Leu Val Ser Asp Phe Leu 20 25 30Asn Val Leu Gly Thr Thr Leu Gly Gln Trp Ser Leu Ser Thr Thr Phe 35 40 45Ala Phe Lys Arg Leu Thr Thr Lys Lys His Ser Ser Asp Ile Ser Val 50 55 60Glu Ala Gln Lys Glu Ser Val Ala Arg Gly Pro Val Glu Asn Ile Ser 65 70 75 80Gln Ser Val Ala Gln Pro Ile Arg Arg Arg Trp Val Gln Asp Lys Lys 85 90 95Pro Val Thr Tyr Ser Leu Lys Asp Val Ala Ser His Asp Met Pro Gln 100 105 110Asp Cys Trp Ile Ile Ile Lys Glu Lys Val Tyr Asp Val Ser Thr Phe 115 120 125Ala Glu Gln His Pro Gly Gly Thr Val Ile Asn Thr Tyr Phe Gly Arg 130 135 140Asp Ala Thr Asp Val Phe Ser Thr Phe His Ala Ser Thr Ser Trp Lys145 150 155 160Ile Leu Gln Asn Phe Tyr Ile Gly Asn Leu Val Arg Glu Glu Pro Thr 165 170 175Leu Glu Leu Leu Lys Glu Tyr Arg Glu Leu Arg Ala Leu Phe Leu Arg 180 185 190Glu Gln Leu Phe Lys Ser Ser Lys Ser Tyr Tyr Leu Phe Lys Thr Leu 195 200 205Ile Asn Val Ser Ile Val Ala Thr Ser Ile Ala Ile Ile Ser Leu Tyr 210 215 220Lys Ser Tyr Arg Ala Val Leu Leu Ser Ala Ser Leu Met Gly Leu Phe225 230 235 240Ile Gln Gln Cys Gly Trp Leu Ser His Asp Phe Leu His His Gln Val 245 250 255Phe Glu Thr Arg Trp Leu Asn Asp Val Val Gly Tyr Val Val Gly Asn 260 265 270Val Val Leu Gly Phe Ser Val Ser Trp Trp Lys Thr Lys His Asn Leu 275 280 285His His Ala Ala Pro Asn Glu Cys Asp Gln Lys Tyr Thr Pro Ile Asp 290 295 300Glu Asp Ile Asp Thr Leu Pro Ile Ile Ala Trp Ser Lys Asp Leu Leu305 310 315 320Ala Thr Val Glu Ser Lys Thr Met Leu Arg Val Leu Gln Tyr Gln His 325 330 335Leu Phe Phe Leu Val Leu Leu Thr Phe Ala Arg Ala Ser Trp Leu Phe 340 345 350Trp Ser Ala Ala Phe Thr Leu Arg Pro Glu Leu Thr Leu Gly Glu Lys 355 360 365Leu Leu Glu Arg Gly Thr Met Ala Leu His Tyr Ile Trp Phe Asn Ser 370 375 380Val Ala Phe Tyr Leu Leu Pro Gly Trp Lys Pro Val Val Trp Met Val385 390 395 400Val Ser Glu Leu Met Ser Gly Phe Leu Leu Gly Tyr Val Phe Val Leu 405 410 415Ser His Asn Gly Met Glu Val Tyr Asn Thr Ser Lys Asp Phe Val Asn 420 425 430Ala Gln Ile Ala Ser Thr Arg Asp Ile Lys Ala Gly Val Phe Asn Asp 435 440 445Trp Phe Thr Gly Gly Leu Asn Arg Gln Ile Glu His His Leu Phe Pro 450 455 460Thr Met Pro Arg His Asn Leu Asn Lys Ile Ser Pro His Val Glu Thr465 470 475 480Leu Cys Lys Lys His Gly Leu Val Tyr Glu Asp Val Ser Met Ala Ser 485 490 495Gly Thr Tyr Arg Val Leu Lys Thr Leu Lys Asp Val Ala Asp Ala Ala 500

505 510Ser His Gln Gln Leu Ala Ala Ser 515 5201320DNAartificial sequencemodified_base1515 is inosine 13tggtggaart ggamncayaa 201420DNAartificial sequencemodified_base3, 12, 153, 12, 15 are inosine 14kgntggaark rnmancayaa 201520DNAartificial sequence3, 6, 123, 6, 12 are any nucleotidesequencing primer 15atntknggra anarrtgrtg 201618DNAartificial sequencesequencing primer 16cgaatgagtg cgacgaac 181718DNAartificial sequencesequencing primer 17aataacctgg gctctcac 181820DNAartificial sequencesequencing primer 18atgaggatat tgatactctc 201918DNAartificial sequencesequencing primer 19gcaatctggg cattcacg 182018DNAartificial sequencesequencing primer 20gacatcaaag ctcttctc 182118DNAartificial sequencesequencing primer 21ggcgatgag aagtggttc 182226DNAartificial sequencesequencing primer 22ccggtaccat ggccctcgtt accgac 262326DNAartificial sequencesequencing primer 23ccgaattctt agtgagcgtg aagccg 262426DNAartificial sequencesequencing primer 24ccggtaccat ggtgtcccag ggcggc 262526DNAartificial sequencesequencing primer 25ccgaattctc aactcgcagc aagctg 262631DNAartificial sequencesequencing primer 26aaaaggatcc aaaatggccc tcgttaccga c 312727DNAartificial sequencesequencing primer 27aaaagtcgac ttagtgagcg tgaagcc 272860DNAartificial sequencesequencing primer 28gtcgacccgc ggactagtgg gccctctaga cccgggggat ccggatctgc tggctatgaa 60