Gene encoding protein involved in cytokinin synthesis

REFERENCE TO A SEQUENCE LISTING

Incorporated herein by reference in its entirety is a Sequence Listing containing SEQ ID NOs: 1-35.

FIELD OF THE INVENTION

The present invention relates to a gene encoding a protein involved in cytokinin synthesis, a method of utilizing that gene, and a method for acquiring that gene.

BACKGROUND ART

Cytokinins are an important type of plant hormone. They have various effects including induction of cell division, formation of new buds, overcoming dormancy of axillary buds, prevention of aging and promotion of enlargement of fruit. Cytokinins have a structure in which a dimethylallyl group (isopentenyl group) bonds to a nitrogen atom at position 6 of adenine or adenosine, or has a structure in which the isopentenyl group is hydroxylated as their basic skeleton. Some bacteria that are pathogenic to plants are known to have cytokinin synthesis enzymes and among these, the cytokinin synthases of IPT and TZS of Agrobacterium are known to have activity that transfers the dimethylallyl group of dimethylallyl pyrophosphoric acid (DMAPP) to the nitrogen atom at position 6 of adenosine monophosphate (AMP). This reaction is considered to be the most important step in cytokinin synthesis. However, cytokinin synthesis enzymes possessed by plants and the proteins that encode them have yet to be identified.

DISCLOSURE OF THE INVENTION

Therefore, an object of the present invention is to provide a gene that encodes an enzyme that catalyzes cytokinin synthesis, a protein encoded thereby, and its application. In addition, an object of the present invention is to provide a method for identifying that gene.

The inventors of the present invention found a method for obtaining a novel gene that encodes an enzyme that catalyzes cytokinin synthesis from Arabidopsis thaliana, and obtained a novel gene that encodes an enzyme that catalyzes cytokinin synthesis.

Thus, the present invention provides a gene that encodes a protein involved in cytokinin synthesis. More specifically, the protein is a previously unreported enzyme in plants that catalyzes the reaction in which a side chain is introduced at position N6 of the adenine skeleton of cytokinins.

More specifically, the present invention provides a gene that encodes a protein involved in cytokinin synthesis having the amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14. In addition, the present invention provides a gene that encodes a protein involved in cytokinin synthesis having a modified amino acid sequence resulting from the addition and/or deletion of one or a plurality of amino acids and/or substitution by other amino acids in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14. Moreover, the present invention provides a gene encoding a protein involved in cytokinin synthesis that hybridizes with a nucleic acid described in SEQ ID NO. 1, 3, 5, 7, 9, 11 or 13, and particularly DNA or a portion thereof, under stringent conditions.

The present invention also provides a vector that contains that gene.

Moreover, the present invention provides a host that has been transformed by that vector. This host may be a plant cell or a plant body.

The present invention is also able to provide a production method of a protein involved in cytokinin synthesis by culturing and cultivating the aforementioned host.

In addition, the present invention is able to provide a method for regulating the growth of a plant or plant cells by introducing the aforementioned gene into a plant or plant cells and expressing said gene. Namely, various physiological actions in which cytokinins are involved, such as promotion of the formation of adventitious buds, overcoming the dormancy of lateral buds, prevention of the aging of flowers and leaves and the ripening of fruit, improving the longevity of flowers, maintaining photosynthesis function, promoting the enlargement of fruit, prevention of dropping and control of flowering, can be regulated by expressing this gene.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a drawing showing the structure of plasmid pTK015.

FIG. 2 is a photograph of a plant body regenerated from Arabidopsis thaliana transformed by pHM4-AtIPT5.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The inventors of the present invention surmised that the reaction that catalyzes the introduction of an isopentenyl (dimethylallyl) side chain at the N6 position of the adenine skeleton is the rate-limiting step of cytokinin synthesis. Examples of genes that are known to encode isopentenyl group transferases involved in cytokinin synthesis include the ipt (gene4) gene encoded by T-DNA and the tzs gene present in the vir region of the Ti-plasmid of Agrobacterium tumefaciens, the ptz gene present in several species of Pseudomonas, the ipt gene of Rhodococcus faciens, and the etz gene of Erwinia herbicola. Among these, the gene products of the tzs and ipt genes of Agrobacterium, the etz gene of Pseudomonas and the ipt gene of Rhodococcus have been demonstrated to have DMAPP:AMP dimethylallyl transferase activity in vitro. In addition to these, many living organisms have enzymes that transfer an isopentenyl group from DMAPP to rRNA. If plant cytokinins are assumed to be synthesized by isopentenylation of the adenine skeleton, then there is the possibility that enzymes that catalyze this reaction may have amino acids in common with the isopentenyl group transferases mentioned above. Therefore, the amino acid sequences of these gene products were first compared to find the amino acid residues preserved therein. The resulting sequence was determined to be GxTxxGK[ST]xxxxx[VLI]xxxxxxx[VLI][VLI]xxDxxQx[57,60][VLI][VLI]xGG[ST] (SEQ ID NO: 35). Here, x indicates an arbitrary amino acid, amino acid residues enclosed in brackets [ ] indicate which one of the amino acid residues contained therein, and [a,b] indicates the number of arbitrary types of amino acid residues greater than or equal to a but less than or equal to b.

The genome sequence of Arabidopsis thaliana was searched using a TAIR Pattern Matching program to find the possible genes or estimated gene regions based on this amino acid sequence pattern. The resulting eight genes consisted of AT4g24650 (number of the estimated gene region as determined by the Genome Project), T20010.sub.--210 (number of the estimated gene region as determined by the Genome Project), 29375-30301 bp of T16G12 (accession number: AC068809) genome clone, MDB19.12 (number of the estimated gene region as determined by the Genome Project), MVI11.6 (number of the estimated gene region as determined by the Genome Project), T26J14.3 (number of the estimated gene region as determined by the Genome Project), F2J7.12 (number of the estimated gene region as determined by the Genome Project) and AF109376.

Among these eight genes, an estimated gene, AF109376, has been cloned as the cDNA and annotated as being tRNA isopentenyl transferase mRNA. Among the seven remaining genes, T20010.sub.--210, MDB19.12, AT4g24650, MVI11.6, T26J14.3 and F2J7.12 have not being isolated as full length cDNA but estimated genes, and annotated to be likely tRNA isopentenyl transferases. 29375-30301 bp of T16G12 (accession number: AC0699089) genome clone is not even annotated.

The genes or estimated genes of AT4g24650, T20010.sub.--210, cDNA corresponding to 29375-30301 bp of T16G12 (accession number: AC068809) genome clone, MDB19.12, MVI11.6, T26J14.3 and F2J7.12 are designated AtIPT4, AtIPT3, AtIPT5, AtIPT7, AtIPT8 and AtIPT6. In addition, each of their nucleotide sequences are shown with SEQ ID NOs. 1, 3, 5, 7, 9, 11 and 13, and their corresponding amino acid sequences are indicated with SEQ ID NOs. 2, 4, 6, 8, 10, 12 and 14.

Although the calli of Arabidopsis thaliana normally form leaves and buds (to be referred to as shoots) when cytokinins are present in the medium, if cytokinins are not present, it does not form any shoots or even if they are formed, the frequency of formation is extremely low. Therefore, if callus efficiently forms shoots even in the absence of cytokinins when a gene has been introduced and expressed in the callus, the introduced gene can be considered to encode a cytokinin synthase or protein involved in cytokinin reactions.

Alternatively, by expressing the resulting gene using a gene expression system such as E. coli or yeast and then measuring the enzyme activity, the resulting gene can be confirmed to encode a cytokinin synthase or protein involved in cytokinin reactions.

On the basis of the above, in the present invention, a gene that encodes a cytokinin synthase or protein involved in cytokinin synthesis of plant origin was isolated and identified for the first time.

In addition, in the present invention, plant cytokinin synthase was found to transfer the DMA group of DMAPP to ATP and ADP.

Examples of a gene of the present invention include that coding for the amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14. However, proteins having an amino acid sequence that has been modified by addition or deletion or a plurality of amino acids, and/or substitution by other amino acids are known to maintain activity similar to the original protein. Thus, a modified gene that encodes a cytokinin synthase or protein involved in cytokinin synthesis activity and has an amino acid sequence that has been modified with respect to an amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14 by addition or deletion of one or a plurality of amino acids and/or substitution by other amino acids, is also included in the present invention.

Here, the degree of this modification is the degree which is possible by means that were commonly known technologies prior to filing of the present patent application, examples of which include site-specific mutagenesis, PCR method and so on. The number of amino acids subject to modification while maintaining the activity of the cytokinin synthase or that relating to cytokinin synthesis is, for example 100 or less, for example 50 or less, preferably 25 or less, and for example 10 or less.

In addition, the present invention also provides a gene composed of DNA that encodes a cytokinin synthase or protein having activity involved in cytokinin synthesis, and which is capable of hybridizing with a nucleic acid having a nucleotide sequence described in SEQ ID NO. 1, 3, 5, 7, 9, 11 or 13, or portion thereof, under stringent conditions. Here, stringent conditions refer to hybridization conditions consisting of 5.times.SSC and 50.degree. C. Furthermore, as the suitable hybridization temperature varies according to the particular nucleotide sequence and the length of that nucleotide sequence, hybridization can be carried out by suitable selecting the hybridization temperature.

A cDNA library, genomic DNA library and so forth prepared from a plant or microorganism, etc. having cytokinin synthase activity or activity involved in cytokinin synthesis can be used for the source of the gene subjected to the aforementioned hybridization, examples of which include plants such as Arabidopsis thaliana, corn, poplar, petunia, tobacco, rice, tomato and eucalyptus plants.

The nucleotide sequence of a gene encoding a cytokinin synthase or protein involved in cytokinin synthesis obtained in this manner has homology of 50% or more, 60% or more, preferably 70% or more or 80% or more, and for example 90% or more, with respect to a nucleotide sequence indicated in SEQ ID NO. 1, 3, 5, 7, 9, 11 or 13.

As will be concretely indicated in the examples, the subject gene encoding a protein having an amino acid sequence indicated in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14 can be obtained from Arabidopsis thaliana in the form of cDNA or genomic DNA.

In addition, DNA encoding a protein having a modified amino acid sequence can be synthesized using commonly used site-specific mutagenesis or PCR method by using DNA having the inherent nucleotide sequence as a base. For example, a DNA fragment containing a desired modification can be obtained by obtaining a DNA fragment in which a modification is desired to be introduced by restriction enzyme treatment of the inherent cDNA or genomic DNA, and then performing site-specific mutagenesis or PCR method using this DNA as a template and a primer containing the desired mutation. Subsequently, this DNA fragment into which the mutation has been introduced should then be coupled with a DNA fragment that encodes another portion of the target protein.

Alternatively, in order to obtain DNA that encodes protein composed of a shortened amino acid sequence, DNA that encodes an amino acid sequence longer than the target amino acid sequence, such as the entire amino acid sequence, should be digested by a desired restriction enzyme and, if the resulting DNA fragment does not encode the entire target amino acid sequence, a DNA fragment composed of the portion of the sequence that is lacking should be synthesized and then coupled to that fragment.

Alternatively, cytokinin synthase or a protein having activity involved in cytokinin synthesis can also be obtained by using antibody to a protein having an amino acid sequence described in SEQ ID NO. 2, 4, 6, 8, 10, 12 or 14, and cytokinin synthase or protein having activity involved in cytokinin synthesis of other organisms can be cloned using antibody.

Thus, the present invention also relates to a recombinant vector, and particularly an expression vector, that contains the aforementioned gene, and to a host transformed by said vector. Procaryotic organisms or eucaryotic organisms can be used as hosts. Examples of prokaryotic organisms include bacteria such as Escherichia coli and other Escherichia species, Bacillus subtilis and other Bacillus species as well as other commonly used host microorganisms.

Examples of eucaryotic organisms include lower eucaryotic organisms such as eucaryotic microorganisms in the form of yeasts and molds. Examples of yeasts include Saccharomyces cerevisiae and other Saccharomyces species, while examples of molds include Aspergillus oryzae, Aspergillus niger and other Aspergillus species as well as Penicillium species. Moreover, plant cells and animal cells may also be used as hosts, examples of which include cells systems of animals cells such as mouse, hamster, monkey or human cells, and more specifically, COS cells, Vero cells, CHO cells, L cells, C127 cells, BALB/c 3T3 cells and Sp-2/0 cells. Examples of plant cells include tobacco and Arabidopsis cultured cells as well as cultured cells of poplar, eucalyptus and acacia species.

Moreover, insect cells such as silkworm (Bombyx mori) cells or adult silkworms themselves can be used as hosts. In addition, yoga (Spodoptera frugiprd) or cabbage looper (Trichoplusiani) cells can also be used.

Plasmids, phages, phagemids and viruses (such as Baculovirus (expression in insects) or Vaccinia virus (expression in animal cells)) can be used as expression vectors.

Expression vectors of the present invention contain expression control regions such as promoters, terminators, replication origins and so forth depending on the type of host into which they are to be introduced. Examples of promoters of bacterial expression vectors include lac promoter, examples of yeast promoters include glyceraldehyde 3-phosphate dehydrogenase promoter, PHO5 promoter, adhI promoter and pqk promoter, and examples of mold promoters include amylase promoter and trpC promoter.

In addition, examples of insect promoters include Baculovirus polyhedron promoter, and examples of animal cell promoters include Simian Virus 40 early and late promoters, CMV promoter, HSV-TK promoter or SR.alpha. promoter. Examples of plant promoters include the 35S promoter of cauliflower mosaic virus and nopaline synthase promoter, while examples of inductive promoters include glutathione-S-transferase II gene promoter, hsp80 promoter and ribulose 2-phosphate carboxylase small subunit gene promoter.

In addition, preferable modes of the expression vector include, in addition to those described above, those containing enhancers, splicing signals, poly A addition signals or selection markers (for example, dihydrofolic acid reductase genes (methotrexate resistant) and neo genes (G418 resistant)). Furthermore, in the case of using an enhancer, SV40 enhancer, for example, is inserted upstream or downstream from the gene.

Host transformation by an expression vector can be carried out in accordance with ordinary methods well known among persons with ordinary skill in the art, and these methods are described in, for example, Current Protocols in Molecular Biology, John Wiley & Sons Publishing, 1995. Culturing of the transformant can also be carried out in accordance with ordinary methods. Purification of protein involved in cytokinin synthesis from the culture can be carried out in accordance with ordinary methods for isolating and purifying proteins, examples of which include ultrafiltration and various types of column chromatography such as chromatography using Sepharose.

On the basis of the current level of technology, adventitious bud formation can be promoted even in plants such as roses, for which individual regeneration is difficult even by artificial regulation using plant hormones externally added to the medium, by inserting and expressing this gene in a plant by coupling this cDNA or gene under the control of a composite or inductive promoter with a system that uses Agrobacterium or a system that uses a particle gun or electroporation and so forth. Moreover, the various physiological actions exhibited by cytokinins in plants, such as lateral bud elongation, prevention of aging, flowering time, promotion of fruit enlargement and prevention of fruit dropping, can be regulated by controlling the expression of a gene that encodes a protein involved in cytokinin synthesis.

The following provides a detailed description of the present invention according to examples. Unless stated otherwise, molecular biological techniques are in accordance with Molecular Cloning (Sambrook, et al., 1989).

Example 1

Search for and Isolation of Genes Encoding Proteins Involved in Cytokinin Synthesis

As a result of analyzing the amino acid sequences of the gene products of the tzs gene of Agrobacterium tumefaciens (Accession No. X03933-1, Protein ID No. CAA27572.1), the ipt gene of Agrobacterium tumefaciens (Accession No. AB025109-1, Protein ID No. BAA76344.1), the ptz gene of Pseudomonas syringae (Accession No. X03679-1, Protein ID No. CAA27315.1), the ipt gene of Rhodococcus faciens (Accession No. Z29635-4, Protein ID No. CAA82744.1), the dimethylallyl transferase gene of Erwinia herbicola (Accession No. Z46375-2, Protein ID No. CAA86510.1) and the delta-2-isopentenyl phosphate (IPP) transferase gene of Escherichia coli tRNA (Accession No. U14003-83, Protein ID No. AAA97067.1) using the amino acid sequence comparison software, Clustal V of Macvector 6.5.3, the preserved sequence of GxTxxGK[ST]xxxxx[VLI]xxxxxxx[VLI][VLI]xxDxxQx [57,60][VLI][VLI]xGG[ST] (SEQ ID NO: 35) was found. Here, x indicates an arbitrary amino acid, amino acid residues enclosed in brackets [ ] indicate which one of the amino acid residues contained therein, and [a,b] indicates the number of arbitrary types of amino acid residues greater than or equal to a but less than or equal to b.

Next, in order to isolate those genes or estimated gene regions considered to have this preserved amino acid sequence pattern, a search was made of the genomic database of Arabidopsis thaliana using the TAIR Pattern Matching Program. As a result, eight genes consisting of the estimated gene region numbers as designated by the National Genome Project of AT4g24650, T20010.sub.--210, MDB19.12, MVI11.6, T26J14.3, F2J7.12, AF109376 and the 29375-30301 bp region of the T16G12 genome clone (Accession No. AC068809) were determined to have the aforementioned preserved amino acid sequence pattern.

Among these eight genes, cDNA has previously been cloned for AF109376 only, and is annotated as tRNA isopentenyl transferase mRNA. However, since the total length cDNA of AT4g24650, T20010.sub.--210, MDB19.12, MVI11.6, T26J14.3 and F2J7.12 have not been isolated, they are annotated as probably being tRNA isopentenyl transferases. With respect to the 29375-30301 bp region of the genome clone of T16G12 (Accession No. AC068809), there are even no annotations regarding its estimated function. Namely, the functions of these eight genes are only estimated on the basis of computer analyses, while there have been no experimental analyses whatsoever, and their functions were not known. In addition, their enzyme activity has also not been measured, and their substrates have not been identified.

The nucleotide sequences of AT4g24650 (AtIPT4), T2000.sub.--210 (AtIPT3), the cDNA corresponding to the 29375-30301 bp region of the genome clone of T16G12 (Accession No. AC068809) (AtIPT5), MDB19.12 (AtIPT7), MVI11.6 (AtIPT8), T26J14.3 (AtIPT1) and F2J7.12 (AtIPT6) are shown in SEQ. ID NOs. 1, 3, 5, 7, 9, 11 and 13.

In addition, a molecular phylogenetic tree was produced with the Clustal W Program (retrieved from the internet:<URL: http://www.ddbj.nig.ac.jp/E-mail/clustalw-e.htm>, Thompson, et al., 1994, Nucl. Acids Res., 22, 4673-4680), including each of the amino acids encoded by them (SEQ ID NOs. 2, 4, 6, 8, 10, 12 and 14) and homologous amino acid sequences obtained as a result of searching DNA databases (such as the DNA Databank of Japan (DDBJ) (retrieved from the internet:<http://www.ddbj.nig.ac.j>). As a result, the sequence indicated with SEQ ID NOs. 2, 4, 6, 8, 10, 12 and 14 were demonstrated to form a family with eucaryotic or bacterial DMAPP:tRNA isopentenyl transferase or isopentenyl transferase involved in cytokinin synthesis of plant pathogens such as Agrobacterium that form gall. Moreover, the amino acid sequences indicated in SEQ ID NOs. 2, 10, 12 and 14 formed a single subgroup. Those genes that were related to this subgroup consisted of AAL83819 (DDBJ accession no.) of petunia origin and BAB86364 (DDBJ accession no.) of rice origin. In addition, the amino acid sequences indicated in SEQ ID NOs. 4, 6 and 8 also formed a single subgroup, and AW720363 (DDBJ accession no.) of bird's-foot trefoil Lotus japonicus origin was positioned in this subgroup.

Example 2

Excessive Expression in Plants of Genes Encoding Proteins Involved in Cytokinin Synthesis

i) Production of Gene Insertion Vector for Plants

pBI35T (WO 01/16332) was treated with EcoRI and HindIII to obtain a DNA fragment containing a promoter of cauliflower mosaic virus 35S RNA gene, a multi-cloning site and the terminator of 35S RNA gene. This was then treated with HindIII and EcoRI of pGPTV-KAN (Becker, R., et al., Plant Molecular Biology, 20, 1195-1197, 1992), and among the two fragments formed, the longer fragment was ligated to obtain pTK015 (FIG. 1). Similarly, this DNA fragment containing a promoter of cauliflower mosaic virus 35S RNA gene, a multi-cloning site and the terminator of 35S RNA gene was then treated with HindIII and EcoRI of pGPTV-Bar (Becker, R., et al., Plant Molecular Biology, 20, 1195-1197, 1992), and among the two fragments formed, the longer fragment was ligated to obtain pTK016.

For the predicted open reading frame of AF109376, DNA was amplified by incubating at 94.degree. C. for 2 minutes followed by 40 cycles consisting of 15 seconds at 94.degree. C., 30 seconds at 53.degree. C. and 2 minutes and 40 seconds at 68.degree. C. using the cDNA library of Arabidopsis thaliana for the template DNA of the PCR reaction, primer 398 (5'-TCCCCCGGGCGATGATGATGTTAAACCCTAGC-3') (SEQ ID NO. 15) and primer 399 (5'-TCCCCCGGGTC AATTTACTTCTGCTTCTTGAACTTC) (SEQ ID NO. 16) as primers and pfx DNA polymerase (Gibco BRL), and purifying the amplified DNA followed by treatment with SmaI and repeated purification of the DNA. This was then cloned to the SmaI site of pTK015, after which the cloned product in the sense direction downstream from the 35S RNA gene promoter (35S promoter) of cauliflower mosaic virus was selected and designated as pTK015-AF109376.

AtIPT4 was amplified by incubating at 94.degree. C. for 2 minutes followed by 42 cycles consisting of 15 seconds at 94.degree. C., 20 seconds at 53.degree. C. and 1 minute at 68.degree. C. using the genomic DNA of Arabidopsis thaliana for the template of the PCR reaction, primer 421 (AAAATGAAGTGTAATGACAAAATGGTTGTG-3') (SEQ ID NO. 17) and primer 407 (5'-GTCCAAACTAGTTAAGACTTAAAAATC-3') (SEQ ID NO. 18) as primers and pfx DNA polymerase (Gibco BRL), followed by purification and cloning to the SmaI site of pTK015. The cloned product in the sense direction downstream from the 35S promoter was designated as pTK015-AtIPT4.

For AtIPT3, DNA was amplified using genomic DNA of Arabidopsis thaliana for the template, primer 703 (5'-CACCAGCAAGTTTATATTGCAAAGCGT-3') (SEQ ID NO. 19) and primer 705 (5'-GTTGTAACCACGTAAAAGATAAGGGTG-3') (SEQ ID NO. 20) as primers and Herculase (trade name, Stratagene) as heat-resistant DNA synthase. The PCR reaction was carried out for 1 minute at 92.degree. C. followed by 35 cycles consisting of 30 seconds at 92.degree. C., 30 seconds at 55.degree. C. and 2 minutes and 30 seconds at 70.degree. C. Following purification of this product, it was cloned at the blunt terminal to the SmaI site of pTK016, and the cloned product of AtIPT3 in the sense direction downstream from the 35S promoter was selected and designated as pTK016-AtIPT3.

For pTK015, after digesting with SmaI and KpnI, the DNA was purified using the QUIAquick PCR Purification Kit (Qiagen). Here, the sequence of the multi-cloning site was altered by cloning primer 852(5'-CTCGAGTTGGCGCGCCACCCGGGATTAATTAAGAC TAGTGGGGTAC-3') (SEQ ID NO. 27) and primer 853 (5'-CCCACTAGTCTTAATTAA TCCCGGGTGGCGCGCCAACTCGAG-3') (SEQ ID NO. 28). Here, since primer 852 and primer 853 are synthetic DNA having mutually complementary sequences, this procedure was carried out by incubating the three elements consisting of a fragment obtained by digesting pTK015 with SmaI and KpnI, primer 852 and primer 853 in the presence of ligase under ordinary conditions. The plasmid produced in this manner was designated as pHM4. The only difference between pHM4 and pTK015 is the sequence of the multi-cloning site. Those unique sites present in the multi-cloning site of pTK015 consist of XbaI, XhoI, SmaI, PacI, SpeI, KpnI and SalI.

4 .mu.g of pHM4 were digested with 20 units of BamHI. The terminals were blunted by incubating half the amount for 30 minutes at 70.degree. C. in the presence of 200 .mu.M deoxyATP, deoxyTTP, deoxyCTP, deoxyGTP and 1 unit of pfu DNA polymerase (Stratagene). After treating this for 1 hour at 37.degree. C. with 20 units of calf intestine alkaline phosphatase (Takara), the DNA was purified using the QUIAquick PCR Purification Kit (Qiagen). Here, the cloned DNA fragment that was amplified (for 35 cycles consisting of 20 seconds at 94.degree. C., 30 seconds at 55.degree. C. and 1 minute at 72.degree. C.) from genomic DNA of Arabidopsis thaliana using Herculase heat-resistant DNA polymerase (Stratagene), primer 918 (5'-ATG ACA GAA CTC AAC TTC CAC CT-3') (SEQ ID NO. 29) and primer 879 (5'-CAAAAAAAAGATCTAATTTTGCACCAAATGCCGCTT-3') (SEQ ID NO. 30) was cloned and designated as pHM4-AtIPT1.

A cloned DNA fragment amplified from the genomic DNA of Arabidopsis thaliana using primer 533 (5'-ATTATGCAAAATCTTACG TCCACATTCGTC-3') (SEQ ID NO. 31) and primer 881 (5'-ACAGGATCCTCACACTTTGTCTTTCACCAAG-3') (SEQ ID NO. 32) was cloned in the same manner as the production of pHM4-AtIPT1 and designated as pHM4-AtIPT8.

A sequence containing the entire code region of SEQ ID NO. 6 starting 66 bps upstream from the translation starting point ATG described in SEQ ID NO. 5 was amplified by PCR using genomic DNA extracted from a Columbia wild strain (Takara Shuzo) as a template and using primer 856 (5'-CCGCTCGAGA TGAAGCCATGCATGACGGCTC-3') (SEQ ID NO. 33) and primer 857 (5'-GGACTAGTCACCGGGAAATCGCCGCCA-3') (SEQ ID NO. 34). These primers contain restriction enzyme sites and were treated with XhoI and SpeI following PCR. This DNA fragment was cloned to pHM4, a vector excessive expression in plants, and designated as pHM4-AtIPT5.

ii) Gene Insertion into Plants

pTK015, pTK015-AF109376, pTK015-AtIPT4 and pTK016-AtIPT3 were inserted into the callus of Arabidopsis thaliana using Agrobacterium. The method for inserting genes using Agrobacterium was in accordance with the method of Akama, et al. (Akama, K. et al., 1992 Plant Cell Rep., 12, 7-11). The calli containing the inserted genes were cultured in two types of media consisting of cytokinin-free medium [GM medium (Akama, K. et al., 1992 Plant Cell Rep., 12, 7-11) containing 50 .mu.g/ml of kanamycin sulfate, 100 .mu.g/ml of cefotaxime, 100 .mu.g/ml of vancomycin and 0.3 .mu.g/ml of indole acetate] and cytokinin-containing medium (cytokinin-free medium containing 0.5 .mu.g/ml of trans-zeatin). When observed two weeks later, neither the calli transformed with pTK015 or calli transformed with pTK015-AF109376 formed shoots in the cytokinin-free medium, and only formed shoots in the cytokinin-containing medium. In contrast, the calli transformed with pTK015-AtIPT4 formed shoots in both the cytokinin-free and cytokinin-containing medium. In addition, calli transformed with pTK016-AtIPT3 similarly formed shoots in both the cytokinin-free and cytokinin-containing media.

In addition, calli of Arabidopsis thaliana respectively inserted with pHM4, pHM4-AtIPT1, pHM4-AtIPT8 and pHMR-AtIPT5 were cultured in cytokinin-free medium containing 0.2 .mu.g/ml of indole acetate, 50 .mu.g/ml of kanamycin and 100 .mu.g/ml of claforan. The procedure was the same as the example in which AtIPT4 was inserted into calli. Although the calli containing pHM4 did not form shoots, the calli containing pHM4-AtIPT1, pHM4-AtIPT8 and pHM4-AtIPT5 formed shoot tissue.

On the basis of these findings, AtIPT4 and AtIPT3 were suggested to have the ability to induce shoots and the ability to synthesis cytokinins.

In addition, it was also indicated that excessive expression of AtIPT1, AtIPT5 and AtIPT3 is capable of causing a cytokinin response.

iii) Excessive Expression of pHM4-AtIPT5 in Plants

pHM4-AtIPT5 was transformed in Arabidopsis thaliana using the vacuum infiltration Agrobacterium infection method (O. Araki, Shujunsha Publishing, Cell Engineering Supplement, Plant Cell Engineering Series 4, Experimental Protocols in Model Plants, p. 109-113). The resulting seeds were cultivated in MS agar medium containing 50 .mu.g/ml of kanamycin followed by selection of transformants. When the transformants were cultivated in vermiculite containing one-half the concentration of MS medium, an extremely large number of lateral buds were formed in several of the plants (causing the plants to appear bushy) (FIG. 2). This phenotype was not observed in pHM4 transformants cultivated as a control. As a result, it was determined that when AtIPT5 is expressed in excess, terminal bud dominance diminishes and lateral bud formation is promoted.

Example 3

Measurement of Enzyme Activity of Proteins Involved in Cytokinin Synthesis

i) Plasmid Production for Measuring Enzyme Activity

The code region was amplified by using the pTK015-AtIPT4 produced in Example 2 as a template, using primer 480 (5'-GGAATTCCATATGAAGTGTAATGACAAAATGGTTGA^3') (SEQ ID NO. 21) and primer 481 (5'-GAAGATCTGTCCAAACTAGTTAAGACTTAAAAA TC-3') (SEQ ID NO. 22) as primers, and using LA taq (Takara Shuzo). After purifying the amplified region, it was treated with NdeI and BglII followed by again purifying the DNA. This DNA fragment was cloned between the NdeI and BamHI sites of pET16b (Novagen) to produce pET16b-AtIPT4.

In addition, the coding region was amplified using pTK015-AF109376 as the template for the PCR reaction, using primer 550 (5'-GATCCCCGGCATATGATGATGTTAAACCCTAGC-3') (SEQ ID NO. 23) and primer 551 (5'-ACGGTACCCATA TGTCAATTTACTTCTGCTTCTTGAAC-3') (SEQ ID NO. 24) as primers, and using Herculase (Stratagene) as heat-resistant DNA polymerase. This was then treated with NdeI and cloned to the NdeI site of pET16b to produce pET16b-AF109376.

Moreover, the coding region was amplified using genomic DNA of Arabidopsis thaliana as the template for the PCR reaction, using primer 741 (5'-TTATACATATGAAGCCATGCATGACGGCTCTAAG-3') (SEQ ID NO. 25) and primer 742 (5'-CGGGATCCTCACCGGG AAATCGCCGCCA-3') (SEQ ID NO. 26) as primers, and using LA taq (Takara Shuzo) as heat-resistant enzyme. Following purification, the DNA was treated with NdeI and BamHI and cloned between the NdeI and BamHI sites of pET15b (Novagen) to produce pET15b-AtIPT5.

ii) Measurement of Enzyme Activity of E. Coli Extract

As was previously described, AtIPT1, AtIPT4, AtIPT8 and AtIPT6 form a single subgroup, while AtIPT3, AtIPT5 and AtIPT7 form a different subgroup. Enzyme activity in E. coli was measured from each for a single gene.

After culturing E. coli strain AD494(DE3)pLysS containing pET16b-AtIPT4, pET16b-AF109376 or pET15b-AtIPT5 for 12 hours at 20.degree. C. in the presence of 1 mM IPTG, the microorganisms were collected by centrifugation, and after adding Buffer A (25 mM Tris-HCl, 50 mM KCl, 5 mM .beta.-mercaptoethanol, 1 mM PMSF and 20 .mu.g/ml of leupeptin) to an OD600 of 100, the E. coli were disrupted by freezing and thawing. The disrupted E. coli were then centrifuged for 10 minutes at 300000 g followed by recovery of the supernatants. 10 .mu.l of these supernatants were mixed with Buffer A containing 60 .mu.M DMAPP, 5 .mu.M [3H]AMP (722 GBq/mmol) and 10 mM MgCl.sub.2 followed by incubation for 30 minutes at 25.degree. C. Subsequently, 50 mM of Tris-HCl (pH 9) was added to this reaction liquid followed by the addition of calf intestine alkaline phosphatase to a concentration of 2 units/30 .mu.l and incubating for 30 minutes at 37.degree. C. to carry out a dephosphatization reaction. As a result of developing the reaction liquid by C18 reversed-phase thin layer chromatography (mobile phase: 50% methanol) and detecting the reaction products by autoradiography, formation of isopentenyl adenosine was confirmed in the reaction liquids containing extracts of E. coli having pET16b-AtIPT4 and pET15b-AtIPT5. However, formation activity of isopentenyl adenosine was not observed in the extract of E. coli containing pET16b-AF109376.

iii) Measurement of Enzyme Activity of Purified Proteins

Similar to Example 3, Part (i), AtIPT4 was cloned in pET32b (Novagen) and an extract was prepared from E. coli in the same manner as Example 3, Part (ii). This was designated as Sample A. 400 .mu.l of Ni-NTA agarose suspension (containing 110 .mu.l of Ni-NTA agarose as precipitate, 30 mM NaH.sub.2PO.sub.4 (pH 8), 15 mM indazole, 0.9 M NaCl, 7.5 mM .beta.-mercaptoethanol, 0.5 mM PMSF and 30 .mu.g/ml of leupeptin) were added to 800 .mu.l of Sample A. This suspension was designated as Sample B. Sample B was then centrifuged to separate into supernatant (Sample C) and precipitate. Washing liquid (consisting of 20 mM NaH.sub.2PO.sub.4 (pH 8), 10 mM indazole, 0.3 M NaCl, 5 mM .beta.-mercaptoethanol, 0.5 mM PMSF and 10 .mu.g/ml of leupeptin) was added to the precipitate, and the Ni-NTA agarose was washed four times using a procedure in which the precipitate was recovered by centrifugation. This Ni-NTA agarose was then suspended in 500 .mu.l of washing liquid and designated as Sample D. 50 .mu.l of Sample D were then mixed with 50 .mu.l of 2.times. reaction liquid (25 mM Tris-HCl (pH 7.5), 75 mM KCl, 10 mM MgCl.sub.2, 10 .mu.g/ml of leupeptin, 1 mM PMSF and 66 .mu.M DMAPP) containing one of the nucleotides of ATP, ADP or AMP or adenosine or adenine at 0.25 .mu.M, which were labeled with .sup.3H, and allowed to react for 30 minutes at 23.degree. C. After adding 700 .mu.l of ethyl acetate to this reaction liquid followed by stirring and centrifuging, 550 .mu.l of the ethyl acetate layer were recovered followed by the addition of 500 .mu.l of distilled water. After stirring and centrifugal separation, 350 .mu.l of the ethyl acetate layer were recovered followed again by the addition of 500 .mu.l of distilled water. After again stirring and separating by centrifugation, 0.5 ml of ACSII (Pharmacia) were added to 50 .mu.l of the ethyl acetate layer followed by measurement of radioactivity with a liquid scintillation counter. As a result, the dimethylallyl group of DMAPP was found to have efficiently transferred to ATP and ADP. Thus, it was shown that the AtIPT4 product has activity that transfers a dimethylallyl group to ATP and ADP.

When the Km for ATP was measured in the presence of 0.4 mM DMAPP using purified recombinant AtIPT4 protein (2 ng/ml), the resulting value was comparable to the Km of 11.1 .mu.M (Morris, et al., Aust. J. Plant Physiol., 20, 621-637, 1993) of tzs for AMP. In addition, when the Km for DMAPP was measured in the presence of 200 .mu.M ATP, the value was 6.5 .mu.M.

Similarly, AtIPT1 also encoded protein having activity that transfers a dimethylallyl group to ATP and ADP.

iv) Identification of Reaction Products

The aforementioned Sample D was mixed with an equal volume of 2.times. reaction liquid (containing 1 mM ATP and 1 mM DMAPP) and allowed to react for 1 hour at 25.degree. C. After centrifuging, the supernatant was divided into two equal portions, and one of the portions was treated with calf intestine alkaline phosphatase in the same manner as previously described. After diluting each portion with 3 volumes of acetone and holding for 30 minutes at -80.degree. C., they were centrifuged for 30 minutes at 17,000.times.g to remove the protein. After drying the supernatant to a solid under reduced pressure, it was dissolved in methanol. A portion of the dried supernatant was fractionated with the Chemocobond ODS-W column (Chemco). Elution was carried out using a linear concentration gradient by first eluting for 15 minutes with 20 mM KH.sub.2PO.sub.4 followed by 30 minutes with an 80% aqueous acetonitrile solution containing K.sub.2HPO.sub.4 ranging from 20 mM to 4 mM. The sample not treated with calf intestine alkaline phosphatase exhibited two main peaks in Chemocobond ODS-W column chromatography. The retention time of the peak that eluted first coincided with the retention time of ATP. The retention time of the peak (Peak A) that eluted later did not coincide with any of the retention times of ATP, adenosine or isopentenyl adenosine. The sample treated with calf intestine alkaline phosphatase also exhibited two main peaks in Chemocobond ODS-W column chromatography. The retention time of the peak that eluted first coincided with the retention time of adenosine, while the retention time of the peak that eluted later (Peak B) coincided with that of isopentenyl adenosine.

After drying the fractions of Peaks A and B, they were dissolved in ethanol and analyzed by fast atom bombardment mass spectrometry (JMS-SX102 or JEOL Mstation, JOEL Datum Ltd.). As a result, a signal originating in the compound of Peak A was unable to be obtained, because of inhibition of ionization by the triphosphate group. Signals originating in the compound of Peak B were observed at m/z values of 336 and 204, with the former corresponding to isopentenyl adenosine, and the latter corresponding to a decomposition product of isopentenyl adenosine. On the basis of the above, Peak A was thought to be isopentenyl ATP (also referred to as iPTP), which is a compound resulting from the phosphatization of isopentenyl adenosine.

When the genes indicated with SEQ ID NOs. 2 and 6 were expressed in E. coli, both exhibited cytokinin synthesis activity. In addition, a cytokinin response was evoked in the case of excessive expression in plants of enzymes of the genes indicated in SEQ ID NOs. 2, 4, 6, 10 and 12. In addition, SEQ ID NOs. 2, 10, 12 and 14 or SEQ ID NOs. 4, 6 and 8 were clearly shown to be extremely closely related in terms of their respective molecular systems. Thus, each of these are considered to be cytokinin synthesis enzymes. Thus, it was possible to control cell division, differentiation, axillary bud length, regulation of nutrient distribution, inhibition of aging, reproductive growth and seed growth by controlling the expression of the genes of the present invention and their analogous genes. In addition, since they are plant genes, the appearance of toxicity and so forth of proteins expressed in plants into which these genes have been inserted is unlikely.

Since ATP can be efficiently used as a substrate of cytokinin synthesis, these genes are expected to function more effectively in plants than cytokinin synthesis genes originating in bacteria using AMP as substrate.

EXPLANATION OF SYMBOLS

PAg7:TERMINATOR OF T-DNA GENE 7 NPTII:NEOMYCIN PHOSPHOTRANSFERASE II PNOS:NOPALINE SYNTHETASE PROMOTER P35S:PROMOTER OF CAULIFLOWER MOSAIC VIRUS 35S RNA GENE PA35S:TERMINATOR OF CAULIFLOWER MOSAIC VIRUS 35S RNA GENE LB:LEFT BORDER OF T-DNA RB:RIGHT BORDER OF T-DNA

SEQUENCE LISTINGS

1

351957DNAArabidopsis thalianaCDS(1)..(954) 1atg aag tgt aat gac aaa atg gtt gtg atc atg ggt gcc acc ggt tct 48Met Lys Cys Asn Asp Lys Met Val Val Ile Met Gly Ala Thr Gly Ser 1 5 10 15ggc aag tca tca ctc tct gtt gat ctc gct tta cat ttt aaa gcc gag 96Gly Lys Ser Ser Leu Ser Val Asp Leu Ala Leu His Phe Lys Ala Glu 20 25 30atc atc aac tct gac aaa atg cag ttc tac gat ggc ttg aag atc acc 144Ile Ile Asn Ser Asp Lys Met Gln Phe Tyr Asp Gly Leu Lys Ile Thr 35 40 45acg aat caa tcg acc att gaa gat cga cgt gga gtg cca cat cac ctt 192Thr Asn Gln Ser Thr Ile Glu Asp Arg Arg Gly Val Pro His His Leu 50 55 60ctc ggt gaa cta aac ccg gag gct gga gaa gtc aca gcg gca gaa ttt 240Leu Gly Glu Leu Asn Pro Glu Ala Gly Glu Val Thr Ala Ala Glu Phe 65 70 75 80cgc gtt atg gcg gct gaa gcc atc tcc gag att act caa cgt aaa aag 288Arg Val Met Ala Ala Glu Ala Ile Ser Glu Ile Thr Gln Arg Lys Lys 85 90 95ctc cca atc ctt gcc ggt gga tcc aac tca tac att cat gct ctc ctt 336Leu Pro Ile Leu Ala Gly Gly Ser Asn Ser Tyr Ile His Ala Leu Leu 100 105 110gca aaa tct tat gac cct gaa aac tat ccg ttt tct gat cac aag ggc 384Ala Lys Ser Tyr Asp Pro Glu Asn Tyr Pro Phe Ser Asp His Lys Gly 115 120 125tca atc tgc tcc gag ttg aaa tat gat tgt tgt ttc att tgg ata gat 432Ser Ile Cys Ser Glu Leu Lys Tyr Asp Cys Cys Phe Ile Trp Ile Asp 130 135 140gtg gat cag tct gtg tta ttc gag tat ctt tct tta cgt ttg gat ctt 480Val Asp Gln Ser Val Leu Phe Glu Tyr Leu Ser Leu Arg Leu Asp Leu145 150 155 160atg atg aag tca ggt atg ttc gag gag atc gct gag ttc cac cgc tct 528Met Met Lys Ser Gly Met Phe Glu Glu Ile Ala Glu Phe His Arg Ser 165 170 175aag aag gcc ccg aaa gag cca ttg ggg ata tgg aag gct ata gga gtg 576Lys Lys Ala Pro Lys Glu Pro Leu Gly Ile Trp Lys Ala Ile Gly Val 180 185 190caa gag ttt gat gac tac ctc aaa atg tac aag tgg gac aat gac atg 624Gln Glu Phe Asp Asp Tyr Leu Lys Met Tyr Lys Trp Asp Asn Asp Met 195 200 205gat aaa tgg gac cct atg aga aag gag gct tat gag aag gcg gtg aga 672Asp Lys Trp Asp Pro Met Arg Lys Glu Ala Tyr Glu Lys Ala Val Arg 210 215 220gcc atc aaa gaa aac aca ttt cag ctc aca aag gat caa atc acg aag 720Ala Ile Lys Glu Asn Thr Phe Gln Leu Thr Lys Asp Gln Ile Thr Lys225 230 235 240atc aac aag ctg aga aat gcc ggg tgg gac ata aag aag gtg gat gct 768Ile Asn Lys Leu Arg Asn Ala Gly Trp Asp Ile Lys Lys Val Asp Ala 245 250 255aca gca tcg ttt cga gag gca att agg gca gcc aag gaa ggc gaa ggt 816Thr Ala Ser Phe Arg Glu Ala Ile Arg Ala Ala Lys Glu Gly Glu Gly 260 265 270gta gcc gag atg cag aga aag ata tgg aac aag gaa gtg ttg gaa ccg 864Val Ala Glu Met Gln Arg Lys Ile Trp Asn Lys Glu Val Leu Glu Pro 275 280 285tgt gtg aag att gtc agg agc cac ttg gac caa ccg atc aac tat tat 912Cys Val Lys Ile Val Arg Ser His Leu Asp Gln Pro Ile Asn Tyr Tyr 290 295 300tat tat tac ttt tat tta cta aaa aga ttt tta agt ctt aac tag 957Tyr Tyr Tyr Phe Tyr Leu Leu Lys Arg Phe Leu Ser Leu Asn305 310 3152318PRTArabidopsis thaliana 2Met Lys Cys Asn Asp Lys Met Val Val Ile Met Gly Ala Thr Gly Ser 1 5 10 15Gly Lys Ser Ser Leu Ser Val Asp Leu Ala Leu His Phe Lys Ala Glu 20 25 30Ile Ile Asn Ser Asp Lys Met Gln Phe Tyr Asp Gly Leu Lys Ile Thr 35 40 45Thr Asn Gln Ser Thr Ile Glu Asp Arg Arg Gly Val Pro His His Leu 50 55 60Leu Gly Glu Leu Asn Pro Glu Ala Gly Glu Val Thr Ala Ala Glu Phe 65 70 75 80Arg Val Met Ala Ala Glu Ala Ile Ser Glu Ile Thr Gln Arg Lys Lys 85 90 95Leu Pro Ile Leu Ala Gly Gly Ser Asn Ser Tyr Ile His Ala Leu Leu 100 105 110Ala Lys Ser Tyr Asp Pro Glu Asn Tyr Pro Phe Ser Asp His Lys Gly 115 120 125Ser Ile Cys Ser Glu Leu Lys Tyr Asp Cys Cys Phe Ile Trp Ile Asp 130 135 140Val Asp Gln Ser Val Leu Phe Glu Tyr Leu Ser Leu Arg Leu Asp Leu145 150 155 160Met Met Lys Ser Gly Met Phe Glu Glu Ile Ala Glu Phe His Arg Ser 165 170 175Lys Lys Ala Pro Lys Glu Pro Leu Gly Ile Trp Lys Ala Ile Gly Val 180 185 190Gln Glu Phe Asp Asp Tyr Leu Lys Met Tyr Lys Trp Asp Asn Asp Met 195 200 205Asp Lys Trp Asp Pro Met Arg Lys Glu Ala Tyr Glu Lys Ala Val Arg 210 215 220Ala Ile Lys Glu Asn Thr Phe Gln Leu Thr Lys Asp Gln Ile Thr Lys225 230 235 240Ile Asn Lys Leu Arg Asn Ala Gly Trp Asp Ile Lys Lys Val Asp Ala 245 250 255Thr Ala Ser Phe Arg Glu Ala Ile Arg Ala Ala Lys Glu Gly Glu Gly 260 265 270Val Ala Glu Met Gln Arg Lys Ile Trp Asn Lys Glu Val Leu Glu Pro 275 280 285Cys Val Lys Ile Val Arg Ser His Leu Asp Gln Pro Ile Asn Tyr Tyr 290 295 300Tyr Tyr Tyr Phe Tyr Leu Leu Lys Arg Phe Leu Ser Leu Asn305 310 31531011DNAArabidopsis thalianaCDS(1)..(1008) 3atg atc atg aag ata tct atg gct atg tgc aaa caa cca ttg cct cct 48Met Ile Met Lys Ile Ser Met Ala Met Cys Lys Gln Pro Leu Pro Pro 1 5 10 15tcg ccg act tta gac ttc cct cca gcg aga ttt ggt ccc aat atg cta 96Ser Pro Thr Leu Asp Phe Pro Pro Ala Arg Phe Gly Pro Asn Met Leu 20 25 30act cta aac cca tac ggt cca aag gac aaa gtt gtg gtc atc atg ggt 144Thr Leu Asn Pro Tyr Gly Pro Lys Asp Lys Val Val Val Ile Met Gly 35 40 45gct acc ggg aca ggc aag tca cga ctc tcc gtg gat ata gcc aca cgt 192Ala Thr Gly Thr Gly Lys Ser Arg Leu Ser Val Asp Ile Ala Thr Arg 50 55 60ttt cgg gct gag atc ata aac tca gac aag ata caa gtc cac caa ggt 240Phe Arg Ala Glu Ile Ile Asn Ser Asp Lys Ile Gln Val His Gln Gly 65 70 75 80cta gac att gta acc aac aag atc acg agc gag gag agc tgc ggg gta 288Leu Asp Ile Val Thr Asn Lys Ile Thr Ser Glu Glu Ser Cys Gly Val 85 90 95ccg cac cat ctc ctc ggc gtc ttg ccg cct gaa gcc gac tta acc gcc 336Pro His His Leu Leu Gly Val Leu Pro Pro Glu Ala Asp Leu Thr Ala 100 105 110gcg aat tac tgt cac atg gcg aat ctc tcc att gaa tcc gtc cta aac 384Ala Asn Tyr Cys His Met Ala Asn Leu Ser Ile Glu Ser Val Leu Asn 115 120 125cgt gga aag ctt cca atc atc gtt gga ggt tcc aac tct tac gtg gag 432Arg Gly Lys Leu Pro Ile Ile Val Gly Gly Ser Asn Ser Tyr Val Glu 130 135 140gct cta gtg gat gac aaa gaa aac aag ttc agg tcg aga tac gac tgt 480Ala Leu Val Asp Asp Lys Glu Asn Lys Phe Arg Ser Arg Tyr Asp Cys145 150 155 160tgt ttt cta tgg gtg gac gtg gca ctt ccc gtt ttg cac ggg ttc gtg 528Cys Phe Leu Trp Val Asp Val Ala Leu Pro Val Leu His Gly Phe Val 165 170 175tct gag aga gtt gac aag atg gtg gag agt gga atg gtt gag gaa gtc 576Ser Glu Arg Val Asp Lys Met Val Glu Ser Gly Met Val Glu Glu Val 180 185 190aga gaa ttt ttc gac ttt tcg aac tct gat tac tca aga ggg atc aag 624Arg Glu Phe Phe Asp Phe Ser Asn Ser Asp Tyr Ser Arg Gly Ile Lys 195 200 205aaa gca atc gga ttt ccg gag ttt gac agg ttt ttc agg aac gag cag 672Lys Ala Ile Gly Phe Pro Glu Phe Asp Arg Phe Phe Arg Asn Glu Gln 210 215 220ttc ttg aat gtg gaa gac aga gaa gaa ctg tta agt aaa gtg ttg gaa 720Phe Leu Asn Val Glu Asp Arg Glu Glu Leu Leu Ser Lys Val Leu Glu225 230 235 240gaa ata aag agg aat aca ttt gag tta gct tgt agg cag aga gaa aag 768Glu Ile Lys Arg Asn Thr Phe Glu Leu Ala Cys Arg Gln Arg Glu Lys 245 250 255atc gaa cgg ttg aga aaa gtg aag aag tgg tct att cag aga gtg gat 816Ile Glu Arg Leu Arg Lys Val Lys Lys Trp Ser Ile Gln Arg Val Asp 260 265 270gcg act cca gtc ttt aca aag cga agg tcc aag atg gat gct aac gtg 864Ala Thr Pro Val Phe Thr Lys Arg Arg Ser Lys Met Asp Ala Asn Val 275 280 285gcc tgg gag agg ctc gtg gct gga cca agc aca gat act gtg tcg cgg 912Ala Trp Glu Arg Leu Val Ala Gly Pro Ser Thr Asp Thr Val Ser Arg 290 295 300ttt ctg ctg gac att gcc agc cga cga ccg ctc gtg gaa gct tca aca 960Phe Leu Leu Asp Ile Ala Ser Arg Arg Pro Leu Val Glu Ala Ser Thr305 310 315 320gcg gtt gcg gcc gcc atg gaa cgc gag ttg tcg cgg tgt cta gtg gcg 1008Ala Val Ala Ala Ala Met Glu Arg Glu Leu Ser Arg Cys Leu Val Ala 325 330 335tga 10114336PRTArabidopsis thaliana 4Met Ile Met Lys Ile Ser Met Ala Met Cys Lys Gln Pro Leu Pro Pro 1 5 10 15Ser Pro Thr Leu Asp Phe Pro Pro Ala Arg Phe Gly Pro Asn Met Leu 20 25 30Thr Leu Asn Pro Tyr Gly Pro Lys Asp Lys Val Val Val Ile Met Gly 35 40 45Ala Thr Gly Thr Gly Lys Ser Arg Leu Ser Val Asp Ile Ala Thr Arg 50 55 60Phe Arg Ala Glu Ile Ile Asn Ser Asp Lys Ile Gln Val His Gln Gly 65 70 75 80Leu Asp Ile Val Thr Asn Lys Ile Thr Ser Glu Glu Ser Cys Gly Val 85 90 95Pro His His Leu Leu Gly Val Leu Pro Pro Glu Ala Asp Leu Thr Ala 100 105 110Ala Asn Tyr Cys His Met Ala Asn Leu Ser Ile Glu Ser Val Leu Asn 115 120 125Arg Gly Lys Leu Pro Ile Ile Val Gly Gly Ser Asn Ser Tyr Val Glu 130 135 140Ala Leu Val Asp Asp Lys Glu Asn Lys Phe Arg Ser Arg Tyr Asp Cys145 150 155 160Cys Phe Leu Trp Val Asp Val Ala Leu Pro Val Leu His Gly Phe Val 165 170 175Ser Glu Arg Val Asp Lys Met Val Glu Ser Gly Met Val Glu Glu Val 180 185 190Arg Glu Phe Phe Asp Phe Ser Asn Ser Asp Tyr Ser Arg Gly Ile Lys 195 200 205Lys Ala Ile Gly Phe Pro Glu Phe Asp Arg Phe Phe Arg Asn Glu Gln 210 215 220Phe Leu Asn Val Glu Asp Arg Glu Glu Leu Leu Ser Lys Val Leu Glu225 230 235 240Glu Ile Lys Arg Asn Thr Phe Glu Leu Ala Cys Arg Gln Arg Glu Lys 245 250 255Ile Glu Arg Leu Arg Lys Val Lys Lys Trp Ser Ile Gln Arg Val Asp 260 265 270Ala Thr Pro Val Phe Thr Lys Arg Arg Ser Lys Met Asp Ala Asn Val 275 280 285Ala Trp Glu Arg Leu Val Ala Gly Pro Ser Thr Asp Thr Val Ser Arg 290 295 300Phe Leu Leu Asp Ile Ala Ser Arg Arg Pro Leu Val Glu Ala Ser Thr305 310 315 320Ala Val Ala Ala Ala Met Glu Arg Glu Leu Ser Arg Cys Leu Val Ala 325 330 3355990DNAArabidopsis thalianaCDS(1)..(990) 5atg aag cca tgc atg acg gct cta aga caa gtg att caa cca ttg tcg 48Met Lys Pro Cys Met Thr Ala Leu Arg Gln Val Ile Gln Pro Leu Ser 1 5 10 15ttg aac ttc caa gga aac atg gtg gac gtt ccg ttt ttc cgg cga aaa 96Leu Asn Phe Gln Gly Asn Met Val Asp Val Pro Phe Phe Arg Arg Lys 20 25 30gac aag gtt gtt ttc gtc atg gga gcc acc gga acc ggc aaa tct cgt 144Asp Lys Val Val Phe Val Met Gly Ala Thr Gly Thr Gly Lys Ser Arg 35 40 45cta gcc att gac cta gcc act cgt ttt ccg gcg gag att gta aac tcc 192Leu Ala Ile Asp Leu Ala Thr Arg Phe Pro Ala Glu Ile Val Asn Ser 50 55 60gac aag atc cag gtc tat aaa ggt cta gac att gtg act aac aaa gtc 240Asp Lys Ile Gln Val Tyr Lys Gly Leu Asp Ile Val Thr Asn Lys Val 65 70 75 80act cct gag gaa agc ctt ggc gtt cct cac cac ctt ctc ggc acc gtc 288Thr Pro Glu Glu Ser Leu Gly Val Pro His His Leu Leu Gly Thr Val 85 90 95cac gac act tac gaa gat ttc acg gcg gag gat ttt cag cgt gaa gca 336His Asp Thr Tyr Glu Asp Phe Thr Ala Glu Asp Phe Gln Arg Glu Ala 100 105 110atc agg gcc gtc gag tca atc gtc cag aga gac cgt gtc ccg atc ata 384Ile Arg Ala Val Glu Ser Ile Val Gln Arg Asp Arg Val Pro Ile Ile 115 120 125gcc ggt ggt tcc aat tct tac atc gag gct ctg gtc aac gat tgc gtt 432Ala Gly Gly Ser Asn Ser Tyr Ile Glu Ala Leu Val Asn Asp Cys Val 130 135 140gac ttc cgg tta agg tat aat tgt tgc ttc ttg tgg gtc gac gtc tct 480Asp Phe Arg Leu Arg Tyr Asn Cys Cys Phe Leu Trp Val Asp Val Ser145 150 155 160aga ccg gtt tta cac tcg ttt gtc tcg gag cga gtt gat aag atg gtt 528Arg Pro Val Leu His Ser Phe Val Ser Glu Arg Val Asp Lys Met Val 165 170 175gat atg ggt ctc gtc gac gag gtt cgc cgc atc ttc gat ccg tct tcg 576Asp Met Gly Leu Val Asp Glu Val Arg Arg Ile Phe Asp Pro Ser Ser 180 185 190tcg gat tac tcc gct gga att cgc cga gcc att gga gtt cca gag ctc 624Ser Asp Tyr Ser Ala Gly Ile Arg Arg Ala Ile Gly Val Pro Glu Leu 195 200 205gac gaa ttt ctc cgt tcg gag atg cgg aat tat ccg gcg gag acg acg 672Asp Glu Phe Leu Arg Ser Glu Met Arg Asn Tyr Pro Ala Glu Thr Thr 210 215 220gag aga ctt ctt gaa acg gcg atc gag aag att aaa gag aac act tgt 720Glu Arg Leu Leu Glu Thr Ala Ile Glu Lys Ile Lys Glu Asn Thr Cys225 230 235 240ttg ctt gcg tgt aga caa ttg cag aag att caa agg ctt tac aag cag 768Leu Leu Ala Cys Arg Gln Leu Gln Lys Ile Gln Arg Leu Tyr Lys Gln 245 250 255tgg aag tgg aac atg cac cgt gtc gac gcg acg gag gtt ttt ctc cga 816Trp Lys Trp Asn Met His Arg Val Asp Ala Thr Glu Val Phe Leu Arg 260 265 270cga gga gaa gaa gct gat gag gct tgg gat aac tca gtg gct cat ccg 864Arg Gly Glu Glu Ala Asp Glu Ala Trp Asp Asn Ser Val Ala His Pro 275 280 285agc gca ctc gcc gtc gaa aag ttc ctt agt tac agc gat gac cac cat 912Ser Ala Leu Ala Val Glu Lys Phe Leu Ser Tyr Ser Asp Asp His His 290 295 300ttg gaa ggc gcc aat att ctc cta ccg gag atc tct gcc gtt ccg cct 960Leu Glu Gly Ala Asn Ile Leu Leu Pro Glu Ile Ser Ala Val Pro Pro305 310 315 320ctt cca gcc gcc gtg gcg gcg att tcc cgg 990Leu Pro Ala Ala Val Ala Ala Ile Ser Arg 325 3306330PRTArabidopsis thaliana 6Met Lys Pro Cys Met Thr Ala Leu Arg Gln Val Ile Gln Pro Leu Ser 1 5 10 15Leu Asn Phe Gln Gly Asn Met Val Asp Val Pro Phe Phe Arg Arg Lys 20 25 30Asp Lys Val Val Phe Val Met Gly Ala Thr Gly Thr Gly Lys Ser Arg 35 40 45Leu Ala Ile Asp Leu Ala Thr Arg Phe Pro Ala Glu Ile Val Asn Ser 50 55 60Asp Lys Ile Gln Val Tyr Lys Gly Leu Asp Ile Val Thr Asn Lys Val 65 70 75 80Thr Pro Glu Glu Ser Leu Gly Val Pro His His Leu Leu Gly Thr Val 85 90 95His Asp Thr Tyr Glu Asp Phe Thr Ala Glu Asp Phe Gln Arg Glu Ala 100 105 110Ile Arg Ala Val Glu Ser Ile Val Gln Arg Asp Arg Val Pro Ile Ile 115 120 125Ala Gly Gly Ser Asn Ser Tyr Ile Glu Ala Leu Val Asn Asp Cys Val 130 135 140Asp Phe Arg Leu Arg Tyr Asn Cys Cys Phe Leu Trp Val Asp Val Ser145 150 155 160Arg Pro Val Leu His Ser Phe Val Ser Glu Arg Val Asp Lys Met Val 165 170 175Asp Met Gly Leu Val Asp Glu Val Arg Arg Ile Phe Asp Pro Ser Ser 180 185 190Ser Asp Tyr Ser Ala Gly Ile Arg Arg Ala Ile Gly

Val Pro Glu Leu 195 200 205Asp Glu Phe Leu Arg Ser Glu Met Arg Asn Tyr Pro Ala Glu Thr Thr 210 215 220Glu Arg Leu Leu Glu Thr Ala Ile Glu Lys Ile Lys Glu Asn Thr Cys225 230 235 240Leu Leu Ala Cys Arg Gln Leu Gln Lys Ile Gln Arg Leu Tyr Lys Gln 245 250 255Trp Lys Trp Asn Met His Arg Val Asp Ala Thr Glu Val Phe Leu Arg 260 265 270Arg Gly Glu Glu Ala Asp Glu Ala Trp Asp Asn Ser Val Ala His Pro 275 280 285Ser Ala Leu Ala Val Glu Lys Phe Leu Ser Tyr Ser Asp Asp His His 290 295 300Leu Glu Gly Ala Asn Ile Leu Leu Pro Glu Ile Ser Ala Val Pro Pro305 310 315 320Leu Pro Ala Ala Val Ala Ala Ile Ser Arg 325 3307990DNAArabidopsis thalianaCDS(1)..(987) 7atg aag ttc tca atc tca tca ctg aag cag gta caa cca atc ttg tgc 48Met Lys Phe Ser Ile Ser Ser Leu Lys Gln Val Gln Pro Ile Leu Cys 1 5 10 15ttc aag aac aag cta tct aag gtc aac gtc aac tct ttt ctc cat ccc 96Phe Lys Asn Lys Leu Ser Lys Val Asn Val Asn Ser Phe Leu His Pro 20 25 30aaa gaa aaa gtc atc ttt gtg atg gga gct acc gga tcg ggt aag tct 144Lys Glu Lys Val Ile Phe Val Met Gly Ala Thr Gly Ser Gly Lys Ser 35 40 45cgt ctc gcc atc gac cta gca act cgt ttt caa gga gag atc ata aac 192Arg Leu Ala Ile Asp Leu Ala Thr Arg Phe Gln Gly Glu Ile Ile Asn 50 55 60tcc gac aag att caa ctt tac aag ggc cta gac gtc cta aca aac aaa 240Ser Asp Lys Ile Gln Leu Tyr Lys Gly Leu Asp Val Leu Thr Asn Lys 65 70 75 80gtc acc cct aaa gaa tgc cga ggc gtg cct cac cac ttg ctt gga gta 288Val Thr Pro Lys Glu Cys Arg Gly Val Pro His His Leu Leu Gly Val 85 90 95ttc gac tcc gaa gcc gga aac cta acg gcc acc cag tat agc cgc ctt 336Phe Asp Ser Glu Ala Gly Asn Leu Thr Ala Thr Gln Tyr Ser Arg Leu 100 105 110gcg tca caa gca atc tcg aaa ctc tca gcg aac aac aag ctt ccc ata 384Ala Ser Gln Ala Ile Ser Lys Leu Ser Ala Asn Asn Lys Leu Pro Ile 115 120 125gta gcc ggt gga tca aac tct tac atc gaa gca ctt gtt aat cat tcc 432Val Ala Gly Gly Ser Asn Ser Tyr Ile Glu Ala Leu Val Asn His Ser 130 135 140tcg ggg ttt tta tta aac aac tac gat tgt tgt ttc att tgg gtc gac 480Ser Gly Phe Leu Leu Asn Asn Tyr Asp Cys Cys Phe Ile Trp Val Asp145 150 155 160gtt tcc tta ccc gta ctt aac tcc ttt gtc tca aaa cgt gtc gac cgc 528Val Ser Leu Pro Val Leu Asn Ser Phe Val Ser Lys Arg Val Asp Arg 165 170 175atg atg gaa gca gga tta ctc gaa gaa gta aga gaa gtg ttc aat cca 576Met Met Glu Ala Gly Leu Leu Glu Glu Val Arg Glu Val Phe Asn Pro 180 185 190aaa gcg aat tac tcc gta ggg ata cga cga gct atc gga gtc ccc gag 624Lys Ala Asn Tyr Ser Val Gly Ile Arg Arg Ala Ile Gly Val Pro Glu 195 200 205ctc cat gaa tat tta cgt aac gaa tct cta gtg gac cgt gcc aca aaa 672Leu His Glu Tyr Leu Arg Asn Glu Ser Leu Val Asp Arg Ala Thr Lys 210 215 220agt aaa atg ctt gac gta gcc gtt aaa aat atc aaa aag aac act gag 720Ser Lys Met Leu Asp Val Ala Val Lys Asn Ile Lys Lys Asn Thr Glu225 230 235 240att tta gct tgt cga cag tta aaa aag att caa cgg ctt cac aag aag 768Ile Leu Ala Cys Arg Gln Leu Lys Lys Ile Gln Arg Leu His Lys Lys 245 250 255tgg aag atg tct atg cat cgt gtt gac gcc act gag gtg ttc ttg aaa 816Trp Lys Met Ser Met His Arg Val Asp Ala Thr Glu Val Phe Leu Lys 260 265 270cgc aac gta gaa gaa caa gac gag gct tgg gag aat ctt gta gcg aga 864Arg Asn Val Glu Glu Gln Asp Glu Ala Trp Glu Asn Leu Val Ala Arg 275 280 285cca agc gag aga atc gtc gat aag ttt tat aat aat aat aac caa ctg 912Pro Ser Glu Arg Ile Val Asp Lys Phe Tyr Asn Asn Asn Asn Gln Leu 290 295 300aaa aat gat gat gtt gag cac tgt ttg gcg gca tct tac ggc gga gga 960Lys Asn Asp Asp Val Glu His Cys Leu Ala Ala Ser Tyr Gly Gly Gly305 310 315 320agt gga agt aga gcc cac aat atg ata tga 990Ser Gly Ser Arg Ala His Asn Met Ile 3258329PRTArabidopsis thaliana 8Met Lys Phe Ser Ile Ser Ser Leu Lys Gln Val Gln Pro Ile Leu Cys 1 5 10 15Phe Lys Asn Lys Leu Ser Lys Val Asn Val Asn Ser Phe Leu His Pro 20 25 30Lys Glu Lys Val Ile Phe Val Met Gly Ala Thr Gly Ser Gly Lys Ser 35 40 45Arg Leu Ala Ile Asp Leu Ala Thr Arg Phe Gln Gly Glu Ile Ile Asn 50 55 60Ser Asp Lys Ile Gln Leu Tyr Lys Gly Leu Asp Val Leu Thr Asn Lys 65 70 75 80Val Thr Pro Lys Glu Cys Arg Gly Val Pro His His Leu Leu Gly Val 85 90 95Phe Asp Ser Glu Ala Gly Asn Leu Thr Ala Thr Gln Tyr Ser Arg Leu 100 105 110Ala Ser Gln Ala Ile Ser Lys Leu Ser Ala Asn Asn Lys Leu Pro Ile 115 120 125Val Ala Gly Gly Ser Asn Ser Tyr Ile Glu Ala Leu Val Asn His Ser 130 135 140Ser Gly Phe Leu Leu Asn Asn Tyr Asp Cys Cys Phe Ile Trp Val Asp145 150 155 160Val Ser Leu Pro Val Leu Asn Ser Phe Val Ser Lys Arg Val Asp Arg 165 170 175Met Met Glu Ala Gly Leu Leu Glu Glu Val Arg Glu Val Phe Asn Pro 180 185 190Lys Ala Asn Tyr Ser Val Gly Ile Arg Arg Ala Ile Gly Val Pro Glu 195 200 205Leu His Glu Tyr Leu Arg Asn Glu Ser Leu Val Asp Arg Ala Thr Lys 210 215 220Ser Lys Met Leu Asp Val Ala Val Lys Asn Ile Lys Lys Asn Thr Glu225 230 235 240Ile Leu Ala Cys Arg Gln Leu Lys Lys Ile Gln Arg Leu His Lys Lys 245 250 255Trp Lys Met Ser Met His Arg Val Asp Ala Thr Glu Val Phe Leu Lys 260 265 270Arg Asn Val Glu Glu Gln Asp Glu Ala Trp Glu Asn Leu Val Ala Arg 275 280 285Pro Ser Glu Arg Ile Val Asp Lys Phe Tyr Asn Asn Asn Asn Gln Leu 290 295 300Lys Asn Asp Asp Val Glu His Cys Leu Ala Ala Ser Tyr Gly Gly Gly305 310 315 320Ser Gly Ser Arg Ala His Asn Met Ile 3259993DNAArabidopsis thalianaCDS(1)..(990) 9atg caa aat ctt acg tcc aca ttc gtc tct cct tcc atg atc ccg atc 48Met Gln Asn Leu Thr Ser Thr Phe Val Ser Pro Ser Met Ile Pro Ile 1 5 10 15act tct ccg cgg ctg cga ctg cca cca cca cga tca gta gtt ccc atg 96Thr Ser Pro Arg Leu Arg Leu Pro Pro Pro Arg Ser Val Val Pro Met 20 25 30act acc gtt tgc atg gaa caa tca tac aag caa aaa gtg gtt gtg atc 144Thr Thr Val Cys Met Glu Gln Ser Tyr Lys Gln Lys Val Val Val Ile 35 40 45atg gga gcc acc gga tca ggc aag tca tgc ctc tca atc gat cta gca 192Met Gly Ala Thr Gly Ser Gly Lys Ser Cys Leu Ser Ile Asp Leu Ala 50 55 60act cgt ttc tct ggc gag atc gtc aat tcc gac aag att caa ttc tac 240Thr Arg Phe Ser Gly Glu Ile Val Asn Ser Asp Lys Ile Gln Phe Tyr 65 70 75 80gat gga ttg aag gtc act acg aat caa atg agc atc ctt gag aga tgt 288Asp Gly Leu Lys Val Thr Thr Asn Gln Met Ser Ile Leu Glu Arg Cys 85 90 95gga gtc cct cac cat ctc ctt ggt gag ctc cct ccg gat gat agc gaa 336Gly Val Pro His His Leu Leu Gly Glu Leu Pro Pro Asp Asp Ser Glu 100 105 110cta act acc tcc gaa ttc cgc tct ttg gcg tcg cgg tcc atc tcc gag 384Leu Thr Thr Ser Glu Phe Arg Ser Leu Ala Ser Arg Ser Ile Ser Glu 115 120 125att act gct cgt gga aac ctc ccg att ata gct ggt gga tca aac tcc 432Ile Thr Ala Arg Gly Asn Leu Pro Ile Ile Ala Gly Gly Ser Asn Ser 130 135 140ttc att cat gct ctc ctt gtc gac cgt ttt gac ccc aaa acc tat cca 480Phe Ile His Ala Leu Leu Val Asp Arg Phe Asp Pro Lys Thr Tyr Pro145 150 155 160ttc tct tct gag aca tcc atc tct tcc ggc ttg agg tac gag tgt tgc 528Phe Ser Ser Glu Thr Ser Ile Ser Ser Gly Leu Arg Tyr Glu Cys Cys 165 170 175ttc ctt tgg gtg gat gtc tca gtg tcg gtc ctg ttc gag tac ctc tcg 576Phe Leu Trp Val Asp Val Ser Val Ser Val Leu Phe Glu Tyr Leu Ser 180 185 190aaa cgt gtc gac cag atg atg gag tca ggg atg ttc gag gag cta gcc 624Lys Arg Val Asp Gln Met Met Glu Ser Gly Met Phe Glu Glu Leu Ala 195 200 205ggt ttc tac gac ccg aga tat tcc ggg tcc gca atc cga gcc cac ggg 672Gly Phe Tyr Asp Pro Arg Tyr Ser Gly Ser Ala Ile Arg Ala His Gly 210 215 220att cac aag acc ata gga ata ccc gag ttc gac cgg tac ttc agc tta 720Ile His Lys Thr Ile Gly Ile Pro Glu Phe Asp Arg Tyr Phe Ser Leu225 230 235 240tac ccg cct gag aga aag cag aag atg tcc gaa tgg gac caa gca aga 768Tyr Pro Pro Glu Arg Lys Gln Lys Met Ser Glu Trp Asp Gln Ala Arg 245 250 255aag ggg gcg tat gac gaa gct gtc caa gag atc aaa gag aac aca tgg 816Lys Gly Ala Tyr Asp Glu Ala Val Gln Glu Ile Lys Glu Asn Thr Trp 260 265 270agg ctt gcg aag aag cag att gag agg atc atg aag ctg aaa agc agc 864Arg Leu Ala Lys Lys Gln Ile Glu Arg Ile Met Lys Leu Lys Ser Ser 275 280 285gga tgg gac att cag agg ttg gac gct acg ccg tca ttt gga aga tcg 912Gly Trp Asp Ile Gln Arg Leu Asp Ala Thr Pro Ser Phe Gly Arg Ser 290 295 300tca aga gag att tgg gac aat act gtt ttg gat gaa agc atc aag gtt 960Ser Arg Glu Ile Trp Asp Asn Thr Val Leu Asp Glu Ser Ile Lys Val305 310 315 320gtg aaa cgc ttc ttg gtg aaa gac aaa gtg tga 993Val Lys Arg Phe Leu Val Lys Asp Lys Val 325 33010330PRTArabidopsis thaliana 10Met Gln Asn Leu Thr Ser Thr Phe Val Ser Pro Ser Met Ile Pro Ile 1 5 10 15Thr Ser Pro Arg Leu Arg Leu Pro Pro Pro Arg Ser Val Val Pro Met 20 25 30Thr Thr Val Cys Met Glu Gln Ser Tyr Lys Gln Lys Val Val Val Ile 35 40 45Met Gly Ala Thr Gly Ser Gly Lys Ser Cys Leu Ser Ile Asp Leu Ala 50 55 60Thr Arg Phe Ser Gly Glu Ile Val Asn Ser Asp Lys Ile Gln Phe Tyr 65 70 75 80Asp Gly Leu Lys Val Thr Thr Asn Gln Met Ser Ile Leu Glu Arg Cys 85 90 95Gly Val Pro His His Leu Leu Gly Glu Leu Pro Pro Asp Asp Ser Glu 100 105 110Leu Thr Thr Ser Glu Phe Arg Ser Leu Ala Ser Arg Ser Ile Ser Glu 115 120 125Ile Thr Ala Arg Gly Asn Leu Pro Ile Ile Ala Gly Gly Ser Asn Ser 130 135 140Phe Ile His Ala Leu Leu Val Asp Arg Phe Asp Pro Lys Thr Tyr Pro145 150 155 160Phe Ser Ser Glu Thr Ser Ile Ser Ser Gly Leu Arg Tyr Glu Cys Cys 165 170 175Phe Leu Trp Val Asp Val Ser Val Ser Val Leu Phe Glu Tyr Leu Ser 180 185 190Lys Arg Val Asp Gln Met Met Glu Ser Gly Met Phe Glu Glu Leu Ala 195 200 205Gly Phe Tyr Asp Pro Arg Tyr Ser Gly Ser Ala Ile Arg Ala His Gly 210 215 220Ile His Lys Thr Ile Gly Ile Pro Glu Phe Asp Arg Tyr Phe Ser Leu225 230 235 240Tyr Pro Pro Glu Arg Lys Gln Lys Met Ser Glu Trp Asp Gln Ala Arg 245 250 255Lys Gly Ala Tyr Asp Glu Ala Val Gln Glu Ile Lys Glu Asn Thr Trp 260 265 270Arg Leu Ala Lys Lys Gln Ile Glu Arg Ile Met Lys Leu Lys Ser Ser 275 280 285Gly Trp Asp Ile Gln Arg Leu Asp Ala Thr Pro Ser Phe Gly Arg Ser 290 295 300Ser Arg Glu Ile Trp Asp Asn Thr Val Leu Asp Glu Ser Ile Lys Val305 310 315 320Val Lys Arg Phe Leu Val Lys Asp Lys Val 325 330111071DNAArabidopsis thalianaCDS(1)..(1071) 11atg aca gaa ctc aac ttc cac ctc ctc cca ata atc tcc gat cgc ttc 48Met Thr Glu Leu Asn Phe His Leu Leu Pro Ile Ile Ser Asp Arg Phe 1 5 10 15acg acg acg acg aca aca tca ccg tcg ttc tcg tca cat tct tct tct 96Thr Thr Thr Thr Thr Thr Ser Pro Ser Phe Ser Ser His Ser Ser Ser 20 25 30tct tct tct ctt ctc tct ttc acc aaa cga aga cga aaa cac caa cct 144Ser Ser Ser Leu Leu Ser Phe Thr Lys Arg Arg Arg Lys His Gln Pro 35 40 45tta gta tca tcc ata cgc atg gaa cag tca cgg tca cgg aat cgg aaa 192Leu Val Ser Ser Ile Arg Met Glu Gln Ser Arg Ser Arg Asn Arg Lys 50 55 60gac aaa gtc gtc gtc att tta gga gca acc ggc gcc gga aaa tca aga 240Asp Lys Val Val Val Ile Leu Gly Ala Thr Gly Ala Gly Lys Ser Arg 65 70 75 80ctt tcc gtc gat ctc gct act cgt ttc cct tca gag atc ata aac tcc 288Leu Ser Val Asp Leu Ala Thr Arg Phe Pro Ser Glu Ile Ile Asn Ser 85 90 95gat aaa atc caa gtc tac gaa gga tta gag atc aca acg aat cag att 336Asp Lys Ile Gln Val Tyr Glu Gly Leu Glu Ile Thr Thr Asn Gln Ile 100 105 110acg tta caa gac cgt cgc ggc gtt cct cac cat ctc ctc ggc gtc atc 384Thr Leu Gln Asp Arg Arg Gly Val Pro His His Leu Leu Gly Val Ile 115 120 125aac ccc gaa cac ggc gaa cta acc gcc gga gag ttt cgc tcc gcc gct 432Asn Pro Glu His Gly Glu Leu Thr Ala Gly Glu Phe Arg Ser Ala Ala 130 135 140tca aac gtc gtc aaa gag ata act tct cgt caa aag gtt ccg att atc 480Ser Asn Val Val Lys Glu Ile Thr Ser Arg Gln Lys Val Pro Ile Ile145 150 155 160gcc ggt gga tct aac tct ttc gtc cac gca ctc tta gct caa cga ttc 528Ala Gly Gly Ser Asn Ser Phe Val His Ala Leu Leu Ala Gln Arg Phe 165 170 175gac cca aag ttc gat cct ttt tca tcc ggg tcg tgt tta atc agc tcc 576Asp Pro Lys Phe Asp Pro Phe Ser Ser Gly Ser Cys Leu Ile Ser Ser 180 185 190gat ttg cgt tac gag tgt tgt ttc atc tgg gtc gat gta tcg gag act 624Asp Leu Arg Tyr Glu Cys Cys Phe Ile Trp Val Asp Val Ser Glu Thr 195 200 205gtt ctc tac gag tat ctt ctc aga aga gtc gac gaa atg atg gat tca 672Val Leu Tyr Glu Tyr Leu Leu Arg Arg Val Asp Glu Met Met Asp Ser 210 215 220ggt atg ttc gaa gag ctg tct aga ttc tac gac ccg gtt aaa tcc ggt 720Gly Met Phe Glu Glu Leu Ser Arg Phe Tyr Asp Pro Val Lys Ser Gly225 230 235 240tta gaa acc cgg ttt ggg att agg aaa gct ata ggt gta ccg gag ttt 768Leu Glu Thr Arg Phe Gly Ile Arg Lys Ala Ile Gly Val Pro Glu Phe 245 250 255gac ggt tac ttc aaa gag tat cca ccg gag aag aag atg ata aag tgg 816Asp Gly Tyr Phe Lys Glu Tyr Pro Pro Glu Lys Lys Met Ile Lys Trp 260 265 270gac gct tta aga aaa gcg gcg tac gat aag gcg gtt gat gat atc aaa 864Asp Ala Leu Arg Lys Ala Ala Tyr Asp Lys Ala Val Asp Asp Ile Lys 275 280 285agg aac acg tgg acg tta gcg aag aga caa gtg aag aag att gag atg 912Arg Asn Thr Trp Thr Leu Ala Lys Arg Gln Val Lys Lys Ile Glu Met 290 295 300cta aaa gac gct ggt tgg gaa ata gaa aga gtt gat gca acg gcg tcg 960Leu Lys Asp Ala Gly Trp Glu Ile Glu Arg Val Asp Ala Thr Ala Ser305 310 315 320ttt aaa gca gtg atg atg aag agt tcg tcg gag aag aag tgg aga gag 1008Phe Lys Ala Val Met Met Lys Ser Ser Ser Glu Lys Lys Trp Arg Glu 325 330 335aat tgg gaa gag caa gtg ttg gag cca agc gta aag att gtg aag cgg 1056Asn Trp Glu Glu Gln Val Leu Glu Pro Ser Val Lys Ile Val Lys Arg 340 345 350cat ttg gtg caa aat 1071His Leu Val Gln Asn 35512357PRTArabidopsis thaliana 12Met Thr Glu Leu Asn Phe His Leu Leu Pro Ile Ile Ser Asp Arg Phe 1

5 10 15Thr Thr Thr Thr Thr Thr Ser Pro Ser Phe Ser Ser His Ser Ser Ser 20 25 30Ser Ser Ser Leu Leu Ser Phe Thr Lys Arg Arg Arg Lys His Gln Pro 35 40 45Leu Val Ser Ser Ile Arg Met Glu Gln Ser Arg Ser Arg Asn Arg Lys 50 55 60Asp Lys Val Val Val Ile Leu Gly Ala Thr Gly Ala Gly Lys Ser Arg 65 70 75 80Leu Ser Val Asp Leu Ala Thr Arg Phe Pro Ser Glu Ile Ile Asn Ser 85 90 95Asp Lys Ile Gln Val Tyr Glu Gly Leu Glu Ile Thr Thr Asn Gln Ile 100 105 110Thr Leu Gln Asp Arg Arg Gly Val Pro His His Leu Leu Gly Val Ile 115 120 125Asn Pro Glu His Gly Glu Leu Thr Ala Gly Glu Phe Arg Ser Ala Ala 130 135 140Ser Asn Val Val Lys Glu Ile Thr Ser Arg Gln Lys Val Pro Ile Ile145 150 155 160Ala Gly Gly Ser Asn Ser Phe Val His Ala Leu Leu Ala Gln Arg Phe 165 170 175Asp Pro Lys Phe Asp Pro Phe Ser Ser Gly Ser Cys Leu Ile Ser Ser 180 185 190Asp Leu Arg Tyr Glu Cys Cys Phe Ile Trp Val Asp Val Ser Glu Thr 195 200 205Val Leu Tyr Glu Tyr Leu Leu Arg Arg Val Asp Glu Met Met Asp Ser 210 215 220Gly Met Phe Glu Glu Leu Ser Arg Phe Tyr Asp Pro Val Lys Ser Gly225 230 235 240Leu Glu Thr Arg Phe Gly Ile Arg Lys Ala Ile Gly Val Pro Glu Phe 245 250 255Asp Gly Tyr Phe Lys Glu Tyr Pro Pro Glu Lys Lys Met Ile Lys Trp 260 265 270Asp Ala Leu Arg Lys Ala Ala Tyr Asp Lys Ala Val Asp Asp Ile Lys 275 280 285Arg Asn Thr Trp Thr Leu Ala Lys Arg Gln Val Lys Lys Ile Glu Met 290 295 300Leu Lys Asp Ala Gly Trp Glu Ile Glu Arg Val Asp Ala Thr Ala Ser305 310 315 320Phe Lys Ala Val Met Met Lys Ser Ser Ser Glu Lys Lys Trp Arg Glu 325 330 335Asn Trp Glu Glu Gln Val Leu Glu Pro Ser Val Lys Ile Val Lys Arg 340 345 350His Leu Val Gln Asn 355131029DNAArabidopsis thalianaCDS(1)..(1026) 13atg caa caa ctc atg acc ttg tta tca cca cca ctc tct cat tct tct 48Met Gln Gln Leu Met Thr Leu Leu Ser Pro Pro Leu Ser His Ser Ser 1 5 10 15ctc ctt ccc acc gtc act acc aaa ttc ggg tca cca cga tta gtc act 96Leu Leu Pro Thr Val Thr Thr Lys Phe Gly Ser Pro Arg Leu Val Thr 20 25 30acg tgc atg ggc cat gca ggg cgt aaa aat atc aag gat aag gtg gtt 144Thr Cys Met Gly His Ala Gly Arg Lys Asn Ile Lys Asp Lys Val Val 35 40 45ctc atc aca ggt aca aca ggc aca ggc aag tca cgc ctc tca gtc gat 192Leu Ile Thr Gly Thr Thr Gly Thr Gly Lys Ser Arg Leu Ser Val Asp 50 55 60ctt gcc acc cgt ttt ttt ccc gcc gag atc ata aac tcg gac aaa atg 240Leu Ala Thr Arg Phe Phe Pro Ala Glu Ile Ile Asn Ser Asp Lys Met 65 70 75 80caa atc tac aag gga ttc gag att gtc aca aat cta atc cca ctg cat 288Gln Ile Tyr Lys Gly Phe Glu Ile Val Thr Asn Leu Ile Pro Leu His 85 90 95gag caa gga gga gtc ccg cac cat ctt cta ggt cag ttc cac cca caa 336Glu Gln Gly Gly Val Pro His His Leu Leu Gly Gln Phe His Pro Gln 100 105 110gac ggt gaa ctc acc cct gca gag ttc cgt tct ttg gcg aca ctg tcc 384Asp Gly Glu Leu Thr Pro Ala Glu Phe Arg Ser Leu Ala Thr Leu Ser 115 120 125atc tct aaa cta att tct agc aag aaa ctc ccg att gta gtt ggt gga 432Ile Ser Lys Leu Ile Ser Ser Lys Lys Leu Pro Ile Val Val Gly Gly 130 135 140tcc aac tcc ttc aat cac gct cta ctc gcc gag cgt ttt gac ccg gat 480Ser Asn Ser Phe Asn His Ala Leu Leu Ala Glu Arg Phe Asp Pro Asp145 150 155 160att gat cca ttc tct ccc gga tcg agt ctt tca acg atc tgc tct gac 528Ile Asp Pro Phe Ser Pro Gly Ser Ser Leu Ser Thr Ile Cys Ser Asp 165 170 175cta agg tac aaa tgt tgc atc tta tgg gtt gat gtt tta gag ccg gtt 576Leu Arg Tyr Lys Cys Cys Ile Leu Trp Val Asp Val Leu Glu Pro Val 180 185 190ctg ttc caa cac ttg tgc aat cgt gtc gac caa atg atc gag tcg gga 624Leu Phe Gln His Leu Cys Asn Arg Val Asp Gln Met Ile Glu Ser Gly 195 200 205ttg gtc gag cag ctt gcc gaa ttg tac gac cct gtt gta gat tcg ggt 672Leu Val Glu Gln Leu Ala Glu Leu Tyr Asp Pro Val Val Asp Ser Gly 210 215 220cga cga cta ggg gtt cgg aag acg ata gga gta gag gag ttc gac cga 720Arg Arg Leu Gly Val Arg Lys Thr Ile Gly Val Glu Glu Phe Asp Arg225 230 235 240tac ttt aga gta tac cct aag gag atg gac aag gga att tgg gac tta 768Tyr Phe Arg Val Tyr Pro Lys Glu Met Asp Lys Gly Ile Trp Asp Leu 245 250 255gcg aga aag gcg gcg tac gag gag aca gtg aag ggg atg aaa gag agg 816Ala Arg Lys Ala Ala Tyr Glu Glu Thr Val Lys Gly Met Lys Glu Arg 260 265 270aca tgt cgg ttg gtg aag aag cag aaa gag aag atc atg aag ctg ata 864Thr Cys Arg Leu Val Lys Lys Gln Lys Glu Lys Ile Met Lys Leu Ile 275 280 285aga ggt ggt tgg gag att aag agg ctt gac gct acg gcg gca att atg 912Arg Gly Gly Trp Glu Ile Lys Arg Leu Asp Ala Thr Ala Ala Ile Met 290 295 300gct gag ctg aat caa agt acg gca aag gga gaa gga aag aat ggg aga 960Ala Glu Leu Asn Gln Ser Thr Ala Lys Gly Glu Gly Lys Asn Gly Arg305 310 315 320gag att tgg gaa aaa cac att gtg gat gaa agt gtc gag att gtc aag 1008Glu Ile Trp Glu Lys His Ile Val Asp Glu Ser Val Glu Ile Val Lys 325 330 335aag ttt ttg ttg gaa gtt tag 1029Lys Phe Leu Leu Glu Val 34014342PRTArabidopsis thaliana 14Met Gln Gln Leu Met Thr Leu Leu Ser Pro Pro Leu Ser His Ser Ser 1 5 10 15Leu Leu Pro Thr Val Thr Thr Lys Phe Gly Ser Pro Arg Leu Val Thr 20 25 30Thr Cys Met Gly His Ala Gly Arg Lys Asn Ile Lys Asp Lys Val Val 35 40 45Leu Ile Thr Gly Thr Thr Gly Thr Gly Lys Ser Arg Leu Ser Val Asp 50 55 60Leu Ala Thr Arg Phe Phe Pro Ala Glu Ile Ile Asn Ser Asp Lys Met 65 70 75 80Gln Ile Tyr Lys Gly Phe Glu Ile Val Thr Asn Leu Ile Pro Leu His 85 90 95Glu Gln Gly Gly Val Pro His His Leu Leu Gly Gln Phe His Pro Gln 100 105 110Asp Gly Glu Leu Thr Pro Ala Glu Phe Arg Ser Leu Ala Thr Leu Ser 115 120 125Ile Ser Lys Leu Ile Ser Ser Lys Lys Leu Pro Ile Val Val Gly Gly 130 135 140Ser Asn Ser Phe Asn His Ala Leu Leu Ala Glu Arg Phe Asp Pro Asp145 150 155 160Ile Asp Pro Phe Ser Pro Gly Ser Ser Leu Ser Thr Ile Cys Ser Asp 165 170 175Leu Arg Tyr Lys Cys Cys Ile Leu Trp Val Asp Val Leu Glu Pro Val 180 185 190Leu Phe Gln His Leu Cys Asn Arg Val Asp Gln Met Ile Glu Ser Gly 195 200 205Leu Val Glu Gln Leu Ala Glu Leu Tyr Asp Pro Val Val Asp Ser Gly 210 215 220Arg Arg Leu Gly Val Arg Lys Thr Ile Gly Val Glu Glu Phe Asp Arg225 230 235 240Tyr Phe Arg Val Tyr Pro Lys Glu Met Asp Lys Gly Ile Trp Asp Leu 245 250 255Ala Arg Lys Ala Ala Tyr Glu Glu Thr Val Lys Gly Met Lys Glu Arg 260 265 270Thr Cys Arg Leu Val Lys Lys Gln Lys Glu Lys Ile Met Lys Leu Ile 275 280 285Arg Gly Gly Trp Glu Ile Lys Arg Leu Asp Ala Thr Ala Ala Ile Met 290 295 300Ala Glu Leu Asn Gln Ser Thr Ala Lys Gly Glu Gly Lys Asn Gly Arg305 310 315 320Glu Ile Trp Glu Lys His Ile Val Asp Glu Ser Val Glu Ile Val Lys 325 330 335Lys Phe Leu Leu Glu Val 3401532DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 15tcccccgggc gatgatgatg ttaaacccta gc 321636DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 16tcccccgggt caatttactt ctgcttcttg aacttc 361730DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 17aaaatgaagt gtaatgacaa aatggttgtg 301827DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 18gtccaaacta gttaagactt aaaaatc 271927DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 19caccagcaag tttatattgc aaagcgt 272027DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 20gttgtaacca cgtaaaagat aagggtg 272135DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 21ggaattccat atgaagtgta atgacaaaat ggttg 352235DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 22gaagatctgt ccaaactagt taagacttaa aaatc 352333DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 23gatccccggc atatgatgat gttaaaccct agc 332438DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 24acggtaccca tatgtcaatt tacttctgct tcttgaac 382533DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 25ttatacatat gaagccatgc atgacggctc tag 332628DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 26cgggatcctc accgggaaat cgccgcca 282746DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 27ctcgagttgg cgcgccaccc gggattaatt aagactagtg gggtac 462842DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 28cccactagtc ttaattaatc ccgggtggcg cgccaactcg ag 422923DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 29atgacagaac tcaacttcca cct 233036DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 30caaaaaaaag atctaatttt gcaccaaatg ccgctt 363130DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 31attatgcaaa atcttacgtc cacattcgtc 303231DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 32acaggatcct cacactttgt ctttcaccaa g 313331DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 33ccgctcgaga tgaagccatg catgacggct c 313427DNAArtificial SequenceDescription of Artificial Sequence Synthetic primer 34ggactagtca ccgggaaatc gccgcca 273596PRTArtificial SequenceDescription of Artificial Sequence Synthetic peptide 35Gly Xaa Thr Xaa Xaa Gly Lys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 1 5 10 15Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Asp Xaa Xaa Gln Xaa Xaa Xaa 20 25 30Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 35 40 45Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 50 55 60Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 80Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Gly Gly Xaa 85 90 95