中文(简体)
Albanian
Arabic
Armenian
Azerbaijani
Belarusian
Bengali
Bosnian
Catalan
Czech
Danish
Deutsch
Dutch
English
Estonian
Finnish
Français
Greek
Haitian Creole
Hebrew
Hindi
Hungarian
Icelandic
Indonesian
Irish
Italian
Japanese
Korean
Latvian
Lithuanian
Macedonian
Mongolian
Norwegian
Persian
Polish
Portuguese
Romanian
Russian
Serbian
Slovak
Slovenian
Spanish
Swahili
Swedish
Turkish
Ukrainian
Vietnamese
Български
中文(简体)
中文(繁體)

Polynucleotides encoding engineered plant cysteine proteases and their uses

只有注册用户可以翻译文章
登陆注册
链接已保存到剪贴板
Ellen Chi
Michael Hunter
Ronald Swanson

关键词

专利信息

专利号8759067
已提起03/21/2013
专利日期06/23/2014

抽象

The present invention relates to potato virus NIa protease variants or fragments thereof, polynucleotides encoding them, and methods of making and using the foregoing.

索偿

The invention claimed is:

1. An isolated polynucleotide encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 13 or the amino acid sequence of residues 1-233 of SEQ ID NO:38, wherein the encoded polypeptide has potato virus A (PVA) nuclear inclusion protein (NIa) protease activity and is more resistant to oxidation than the polypeptide of SEQ ID NO:1.

2. An isolated polynucleotide comprising the nucleotide sequence of SEQ ID NO: 42.

3. A vector comprising the isolated polynucleotide of claim 1.

4. A vector comprising the polynucleotide sequence of SEQ ID NO: 42 or 47.

5. An isolated host cell comprising the vector of claim 3 or 4.

6. A method for expressing a polypeptide comprising the steps of: a. providing the host cell of claim 5; and b. culturing the host cell under conditions sufficient for the expression of at least one polypeptide, wherein the at least one polypeptide comprises the amino acid sequence of SEQ ID NO: 13 or the amino acid sequence of residues 1-233 of SEQ ID NO:38.

描述

FIELD OF THE INVENTION

The present invention relates to potato virus NIa protease variants or fragments thereof, polynucleotides encoding them, and methods of making and using the foregoing.

BACKGROUND OF THE INVENTION

Considerable effort has been employed to engineer enzymes and other proteins to achieve higher selectively and/or specific activity (Matsumura and Ellington, J. Mol. Biol. 305:331-339, 2001; Rothman and Kirsch, J. Mol. Biol. 327:593-608, 2003; Aharoni et al., Nature Genetics, 37:73-76, 2005). Human trypsin-like serine proteases are an appealing target for engineering with the goal to tailor proteases to recognize a specific, predefined primary sequence within a target protein that is normally not recognized, resulting in specific spatial and temporal modulation of target activity. Trypsin-like serine proteases are also valuable research tools in molecular biology.

Manufacturing of trypsin-like serine proteases poses challenges due to their structural complexity related to the required appropriate disulfide bond formation and proper processing of the native globular polypeptide chain for activity. Furthermore, trypsin-like serine proteases often have a constricted recognition sequence limiting the absolute specificity that can be engineered into the molecules. (Gosalia et al., Mol. Cell. Proteomics, 4:626-36, 2005, US Pat. Appl. No. US20040072276A1). An alternative to human trypsin-like serine proteases, intracellular plant viral proteases that are easier to manufacture could be used as a starting point to develop therapeutics as well as new research tools.

Potyviruses are a class of plant viruses transmitted mainly by aphids, causing significant losses in pasture, agricultural, horticultural and ornamental crops annually. Typical representatives of potyviruses are Potato virus A (PVA), tobacco etch virus (TEV) and tobacco vein mottling virus (TVMV). Potyvirus monopartite genome contains (+) stranded RNA, covalently linked to a viral encoded protein (VPg) at the 5'-end and polyadenylated at the 3'-end (Dougherty et al., The EMBO J. 7:1281-1287, 1988). The genome serves as an mRNA and a template for the synthesis of a complementary (-) stranded RNA by a polymerase translated from the viral genome. Upon entry into the cell, the virus RNA binds to endogenous ribosomes and the genome is translated as a single polypeptide chain. The large single polyprotein is subsequently processed into mature proteins by three virus-encoded proteases (Verchot et al., Virology, 190:298-306, 1992), the first protein (P1), the helper component (HC), and the nuclear inclusion protein (NIa) proteases. The NIa protease is responsible for the majority of the polyprotein processing, including the generation of mature RNA replication-associated proteins and capsid proteins (Verchot et al., Virology, 190:298-306, 1992).

The NIa proteases belong to the family of picornavirus 3C cysteine proteases (Parks et al., Virology, 210:194-201, 1995), that exhibit an extended P6-P1' recognition sequence EXXYXQ*(S/G) (SEQ ID NO: 69) (Dougherty et al., Virology, 171:356-364, 1989). Although there are striking similarities in the recognition sequence for NIa proteases across the potyvirus members, each protease is highly specific for its own target sequence (Tozer et al., The FEBS J. 272:514-523, 2004). Structurally, NIa proteases appear to be related to trypsin-like serine proteases through divergent evolution involving replacement of NIa catalytic cysteine by serine in the trypsin-like proteases (Bazan and Fletterick, Proc. Natl. Acad. Sci. 85:7872-7876, 1988). NIa and trypsin-like serine proteases share a similar overall 3-dimensional protein fold as well as the spatial proximity of their respective catalytic residues. The 3C-like family of cysteine proteases offers several advantages over more complex extracellular proteases. They can be easily produced in the cytosol of bacteria, have no disulfide bonds, and have an extended substrate recognition sequence. The challenge of using the 3C-like proteases is their activity loss in non-reducing conditions due to oxidation of active site and/or surface exposed cysteines, therefore limiting their use (Higaki et al., Cold Spring Harbor Symposia on Quantitative Biology, 615-621, 1987). Therefore, the proteases require reducing agent to sustain their functional activity (Nunn et al., J. Mol. Biol. 350:145-55, 2005; Birch et al., Protein Expression and Purification 6:609-18, 1995). Thus, there is a need for engineered plant viral proteases that remain active in the absence of exogenous reducing agents.

SUMMARY OF INVENTION

One aspect of the invention is an isolated polypeptide encoding a NIa protease variant, wherein the variant is resistant to oxidation and retains activity.

Another aspect of the invention is an isolated polypeptide comprising a polypeptide having the sequence shown in SEQ ID NO: 1 having amino acid substitutions selected from the group consisting of: a. cysteine at position 19 is substituted for serine or valine; b. cysteine at position 110 is substituted for serine; c. cysteine at position 151 is substituted for serine or alanine. d. cysteine at position 181 is substituted for serine; and e. cysteine at position 211 is substituted for serine.

Another aspect of the invention is an isolated polypeptide comprising a polypeptide having the sequence shown in SEQ ID NO: 28.

Another aspect of the invention is isolated polynucleotides encoding the polypeptides of the invention.

Another aspect of the invention is a vector comprising an isolated polynucleotide encoding a polypeptide of the invention.

Another aspect of the invention is an isolated host cell comprising the vector of the invention.

Another aspect of the invention is a method for expressing the polypeptides of the invention.

DETAILED DESCRIPTION OF THE INVENTION

All publications, including but not limited to patents and patent applications, cited in this specification are herein incorporated by reference as though fully set forth.

As used herein and in the claims, the singular forms "a," "and," and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to "a polypeptide" is a reference to one or more polypeptides and includes equivalents thereof known to those skilled in the art.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which an invention belongs. Although any compositions and methods similar or equivalent to those described herein can be used in the practice or testing of the invention, exemplary compositions and methods are described herein.

The term "NIa protease" as used herein refers to the potato virus A (PVA) NIa protease encoded by amino acids 2032-2264 of the virus proprotein shown in GenBank Acc. No. CAB58238. The polypeptide sequence of the NIa protease is shown in SEQ ID NO: 1.

The term "polypeptide" as used herein refers to a molecule that comprises at least two amino acid residues linked by a peptide bond to form a polypeptide. Small polypeptides of less than 50 amino acids may be referred to as "peptides". Polypeptides may also be referred as "proteins."

The term "polynucleotide" as used herein refers to a molecule comprising a chain of nucleotides covalently linked by a sugar-phosphate backbone or other equivalent covalent chemistry. Double and single stranded DNAs and RNAs are typical examples of polynucleotides.

The term "complementary sequence" means a second isolated polynucleotide sequence that is antiparallel to a first isolated polynucleotide sequence and that comprises nucleotides complementary to the nucleotides in the first polynucleotide sequence. Typically, such "complementary sequences" are capable of forming a double-stranded polynucleotide molecule such as double-stranded DNA or double-stranded RNA when combined under appropriate conditions with the first isolated polynucleotide sequence.

The term "variant" as used herein refers to a polypeptide or a polynucleotide that differs from a reference "wild type" polypeptide or a polynucleotide and may or may not retain essential properties. Generally, differences in sequences of the wild type and the variant are closely similar overall and, in many regions, identical. A variant may differ from the wild type in its sequence by one or more modifications for example, substitutions, insertions or deletions of nucleotides or amino acids. Substitutions or insertions may result in conservative or non-conservative amino acid substitutions, or in the generation of a stop codon. A variant of a polynucleotide may be naturally occurring, and may have 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the wild type polynucleotide.

It is possible to modify the structure or function of the polypeptides encoded by variant polynucleotide sequences for such purposes as enhancing activity, specificity, stability, solubility, and the like. A replacement of a codon encoding leucine with codons encoding isoleucine or valine, a codon encoding an aspartate with a codon encoding glutamate, a codon encoding threonine with a codon encoding serine, or a similar replacement of codons encoding structurally related amino acids (i.e., conservative mutations) will, in some instances but not all, not have a major effect on the biological activity of the resulting molecule. Conservative replacements are those that take place within a family of amino acids that share chemically related side chains. Naturally occurring amino acids can be divided into four families based on their side chains: (1) acidic (aspartate, glutamate); (2) basic (lysine, arginine, histidine); (3) nonpolar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); and (4) uncharged polar (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine). Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. Alternatively, naturally occurring amino acids can be grouped as (1) acidic (aspartate, glutamate); (2) basic (lysine, arginine histidine), (3) aliphatic (glycine, alanine, valine, leucine, isoleucine, serine, threonine), with serine and threonine optionally be grouped separately as aliphatic-hydroxyl; (4) aromatic (phenylalanine, tyrosine, tryptophan); (5) amide (asparagine, glutamine); and (6) sulfur-containing (cysteine and methionine) (Stryer (ed.), Biochemistry, 2nd ed, WH Freeman and Co., 1981). Whether a change in the amino acid sequence of a polypeptide or fragment thereof encoded by a variant polynucleotide results in a functional homolog can be readily determined by assessing the ability of the modified polypeptide or fragment to produce a response in a fashion similar to the unmodified polypeptide or fragment using the assays described herein. Peptides, polypeptides or proteins in which more than one replacement has taken place can readily be tested in the same manner.

The term "wild type" or "WT" refers to a polypeptide or a polynucleotide that has the characteristics of that polypeptide or polynucleotide when isolated from a naturally occurring source. An exemplary wild type polynucleotide is a polynucleotide encoding a gene that is most frequently observed in a population and is thus arbitrarily designated the "normal" or "reference" or "wild type" form.

The term "activity" or "active" as used herein refers to an active NIa protease, e.g., a NIa protease capable of cleaving its substrate. Exemplary substrates are synthetic peptides corresponding to identified recognition sequences, for example SEVVLFQASS (SEQ ID NO: 70), SEAVYTQGSS (SEQ ID NO: 71), or SENVTFQGSS (SEQ ID NO: 72), as described in Table 5. and in Mertis et al., (Mertis et al., J. Gen. Virol. 83:1211-1221, 2002). Partial cleavage of the substrate is sufficient for effective biological activity of the protease, for example cleavage of 50%, 60%, 70%, 80%, 90%, 95%, or 99% of a substrate. Thus, biological activity does not require complete cleavage of the substrate. "Partially active" refers to a NIa protease that partially cleaves its substrate.

The term "resistant to oxidation" or "oxidation resistant" as used herein means that the NIa protease variant is active and functionally stable in the absence of a reducing agent that is required for functional stability of the wild type NIa protease. The reducing agent required for the activity of the wild type NIa protease can be dithiotreitol (DTT), 2-mercaptoethanol or tris carboxyethylphosphate (TCEP), typically in the range of 0.1-10 mM.

"Heterologous amino acid sequence" as used herein refers to an amino acid sequence not naturally fused to the NIa protease polypeptide. Heterologous amino acid sequences can be attached to either the N- or C-terminus of the NIa protease polypeptide using standard methods. The heterologous sequences can be used to provide a tag for fusion protein purification, such as attachment of polyhistidine or glutamine S-transferase tags, or to increase half life of the NIa protease, such as attachment of a constant domain of an immunoglobulin or albumin, or fragments thereof. Heterologous amino acid sequences can be fused to the polypeptide using well known methods, for example chemical coupling, or via an amide bond. An immunoblogulin hinge or a fragment thereof, a fragment of a variable region of an immunoglobulin, or a linker can also be fused to the NIa protease polypeptide.

The term "vector" means a polynucleotide capable of being duplicated within a biological system or that can be moved between such systems. Vector polynucleotides typically contain elements, such as origins of replication, polyadenylation signal or selection markers, that function to facilitate the duplication or maintenance of these polynucleotides in a biological system. Examples of such biological systems may include a cell, virus, bacteria, animal, plant, and reconstituted biological systems utilizing biological components capable of duplicating a vector. The polynucleotides comprising a vector may be DNA or RNA molecules or hybrids of these.

The term "expression vector" means a vector that can be utilized in a biological system or a reconstituted biological system to direct the translation of a polypeptide encoded by a polynucleotide sequence present in the expression vector.

The present invention provides NIa protease variants that are resistant to oxidation, polynucleotides encoding the variants, vectors comprising these polynucleotides, isolated host cells, methods for expressing the polypeptides of the invention, and methods of using the polynucleotides and polypeptides of the invention. The variants of the invention are useful as research tools, and can be used, e.g., to cleave fusion proteins to remove tags.

One embodiment of the invention is an isolated polypeptide encoding a NIa protease variant, wherein the variant is resistant to oxidation and retains its activity. In oxidizing conditions, i.e., in the absence of a reductant, the wild type NIa aggregates and becomes inactive (Example 1).

In another embodiment, the NIa protease variant resistant to oxidation and retaining its activity has at least one cysteine residue substituted. Other variants may have 2, 3, 4 or 5 cysteine residues substituted. The wild type NIa protease shown in SEQ ID NO: 1 has a total of five cysteines: one active site cysteine at position 151, and four cysteines at positions 19, 110, 181 and 211 which, based on crystal structure predictions are on the surface of the protease and thus susceptible to oxidation. Exemplary substitutions are substitutions for serine, valine or alanine. Sequences of exemplary NIa protease variants are shown in Table 2.

Variants of the invention can be made by well known methods, for example site-directed or random mutagenesis (Kunkel, Proc. Natl. Acad. Sci. USA, 82:488-492, 1985; Weiner et al., Gene, 151:119-123, 1994; Ishii et al., Methods Enzymol., 293:53-71, 1988), or by chemical synthesis (U.S. Pat. No. 6,670,127, U.S. Pat. No. 6,521,427). Rational design can be employed to design variants anticipated to have specific effect on structure or activity of the wild type protease. Whether a change in the amino acid sequence of a polypeptide or fragment thereof results in a functional homolog can be readily determined by assessing the ability of the variant polypeptide or fragment to produce a response in a fashion similar to the wild type polypeptide or fragment using the assays described herein. Peptides, polypeptides or proteins in which more than one replacement has taken place can readily be tested in the same manner. Exemplary assays assessing protease activity measure fluorescence released by a fluorophore/quencher substrate peptide such as 4-(4-dimethylaminophenylazo)benzoyl (DABCYL)-YGENVTFQGSK-5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid (EDANS) (SEQ ID NO: 73) upon proteolysis, or evaluate cleavage of a peptide substrate on SDS-PAGE after protease cleavage.

The polypeptides of the invention may be produced by chemical synthesis, such as solid phase peptide synthesis on an automated peptide synthesizer. Alternatively, the polypeptides of the invention can be obtained from polynucleotides encoding these polypeptides by the use of cell-free expression systems such as reticulocyte lysate based expression systems or by expression and isolation from cells harboring a nucleic acid sequence of the invention by well known techniques, such as recombinant expression of easily isolated affinity labeled polypeptides.

Another embodiment of the invention is an isolated polypeptide comprising a polypeptide having the sequence shown in SEQ ID NO: 1 having substitutions selected from the group consisting of: a. cysteine at position 19 is substituted for serine or valine; b. cysteine at position 110 is substituted for serine; c. cysteine at position 151 is substituted for serine or alanine. d. cysteine at position 181 is substituted for serine; and e. cysteine at position 211 is substituted for serine.

The polypeptides of the invention may comprise fusion polypeptides comprising a polypeptide of the invention fused with a heterologous polypeptide. Such heterologous polypeptides may be leader or secretory signal sequences, a pre- or pro- or prepro-protein sequence, a Histidine tag (His-tag) (Gentz et al., Proc. Natl. Acad. Sci. (USA) 86:821-284, 1989), the HA peptide tag (Wilson et al., Cell 37:767-778, 1984), glutathione-S-transferase, fluorescent tags such as green fluorescent protein (GFP), and the like. Exemplary NIa protease variant-His-tag fusion proteins have amino acid sequences shown in SEQ ID NOs: 37, 38 or 39. In one aspect, the NIa protease variant polypeptide is fused to an immunoglobulin constant domain or a fragment thereof. Such constructs are well known and are described in e.g. U.S. Pat. No. 5,116,964, U.S. Pat. No. 5,709,859, U.S. Pat. No. 6,018,026; WO 04/002417; WO 04/002424; WO 05/081687; and WO 05/032460. Immunoglobulin constant domain may be a CH1, CH2, or a CH3 domain, or a hinge region, and can be derived from IgG1, IgG2, IgG3, IgG4, IgA, IgM, or IgA. The NIa protease variant polypeptide can be fused to an immunoglobulin constant domain or a fragment thereof via a linker, for example a glycine-rich linker, or via a fragment of an immunoglobulin variable region. Such linkers and variable region fragments are described in e.g. WO08/011,446 and U.S. Pat. No. 5,908,626. Exemplary fusion proteins can be formed by conjugating together a NIa protease variant having an amino acid sequence shown in SEQ ID NO: 28 and one or more domains derived from or similar to an immunoglobulin domain, such as CH1, CH2, and CH3 domain.

Another embodiment of an invention is an isolated polypeptide comprising a polypeptide having the sequence shown in SEQ ID NO: 28.

In another embodiment, the invention provides for an isolated polypeptide comprising a polypeptide having the sequence shown in SEQ ID NO: 28.

The polypeptides of the invention can be lyophilized for storage and reconstituted in a suitable carrier prior to use. An exemplary carrier is phosphate buffered saline. This technique has been shown to be effective with conventional protein preparations. Lyophilization and reconstitution techniques are well known in the art, see e.g., Rey and May, Drugs and the Pharmaceutical Sciences Vol. 137, 1999; Wang, Int. J. Pharm. 203:1-60, 2000. These techniques allow for the development of protein formulations with increased long term stability, including storage at room temperature, as well as easier geographical distribution. This process also affords the protein to be used at higher concentrations by adjusting the reconstitution procedure.

Another aspect of the invention is isolated polynucleotides encoding any of the polypeptides of the invention or their complement. Certain exemplary polynucleotides are disclosed herein, however, other polynucleotides which, given the degeneracy of the genetic code or codon preferences in a given expression system, encode the NIa protease variants of the invention are also within the scope of the invention. Exemplary polynucleotides are polynucleotides comprising the nucleic acid sequence shown in SEQ ID NOs: 41-43 and 46-48.

The polynucleotides of the invention may be produced by chemical synthesis such as solid phase polynucleotide synthesis on an automated polynucleotide synthesizer. Alternatively, the polynucleotides of the invention may be produced by other techniques such a PCR based duplication, vector based duplication, or restriction enzyme based DNA manipulation techniques. Techniques for producing or obtaining polynucleotides of a given known sequence are well known in the art.

The polynucleotides of the invention may also comprise at least one non-coding sequence, such as transcribed but not translated sequences, termination signals, ribosome binding sites, mRNA stabilizing sequences, introns and polyadenylation signals.

Another embodiment of the invention is a vector comprising an isolated polynucleotide encoding polypeptides of the invention.

Another embodiment of the invention is a vector comprising an isolated polynucleotide having a sequence shown in SEQ ID NO: 42 or 47. The vectors of the invention are useful for maintaining polynucleotides, duplicating polynucleotides, or driving expression of a polypeptide encoded by a vector of the invention in a biological system, including reconstituted biological systems. Vectors may be chromosomal-, episomal- and virus-derived such as vectors derived from bacterial plasmids, bacteriophages, transposons, yeast episomes, insertion elements, yeast chromosomal elements, baculoviruses, papova viruses such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses, picornaviruses and retroviruses and vectors derived from combinations thereof, such as cosmids and phagemids.

The vectors of the invention can be formulated in microparticles, with adjuvants, lipid, buffer or other excipients as appropriate for a particular application.

In one embodiment of the invention the vector is an expression vector. Expression vectors typically comprise nucleic acid sequence elements that can control, regulate, cause or permit expression of a polypeptide encoded by such a vector. Such elements may comprise transcriptional enhancer binding sites, RNA polymerase initiation sites, ribosome binding sites, and other sites that facilitate the expression of encoded polypeptides in a given expression system. Such expression systems may be cell-based, or cell-free systems well known in the art. Nucleic acid sequence elements and parent vector sequences suitable for use in the expression of encoded polypeptides are also well known in the art.

Another embodiment of the invention is an isolated host cell comprising a vector of the invention. Representative host cell examples include Archaea cells; bacterial cells such as Streptococci, Staphylococci, Enterococci, E. coli, Streptomyces, cyanobacteria, B. subtilis and S. aureus; fungal cells such as Kluveromyces, Saccharomyces, Basidomycete, Candida albicans or Aspergillus; insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293, CV-1, Bowes melanoma and myeloma; and plant cells, such as gymnosperm or angiosperm cells. The host cells in the methods of the invention may be provided as individual cells, or populations of cells.

Introduction of a polynucleotide, such as a vector, into a host cell can be effected by methods well known to those skilled in the art (Davis et al., Basic Methods in Molecular Biology, 2.sup.nd ed., Appleton & Lange, Norwalk, Conn., 1994; Sambrook et al., Molecular Cloning: A Laboratory Manual, 3.sup.rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001). These methods include calcium phosphate transfection, DEAE-Dextran mediated transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction and infection.

Another embodiment of the invention is a method for expressing a polypeptide comprising the steps of providing a host cell of the invention and culturing the host cell under conditions sufficient for the expression of at least one polypeptide of the invention. The polypeptides of the invention comprise polypeptides having an amino acid sequence shown in SEQ ID NOs: 2-34 and 37-39.

Host cells can be cultured under any conditions suitable for maintaining or propagating a given type of host cell and sufficient for expressing a polypeptide. Culture conditions, media, and related methods sufficient for the expression of polypeptides are well known in the art. For example, many mammalian cell types can be aerobically cultured at 37.degree. C. using appropriately buffered DMEM media while bacterial, yeast and other cell types may be cultured at 37.degree. C. under appropriate atmospheric conditions in LB media.

In the methods of the invention the expression of a polypeptide can be confirmed using a variety of different techniques well known in the art. For example, expression of a polypeptide can be confirmed using SDS page, detection reagents, such as antibodies or receptor ligands specific for an expressed polypeptide, or using for example FACS or immunofluorescent techniques.

Other features of the invention will become apparent in the course of the following descriptions of exemplary embodiments which are given for illustration of the invention and are not intended to be limiting thereof.

Example 1

Generation and Characterization of NIa Variants

Cloning and Mutagenesis

The amino acid sequence of potato virus A NIa protease (Genbank Acc. No. CAB58238, amino acids residues 2032-2263), shown in SEQ ID NO: 1, including an N-terminal poly-histidine tag for affinity purification was back translated into a cDNA sequence optimizing codon usage. The full-length cDNA was generated by parsing the sequence into smaller fragments and synthesizing these as oligonucleotides using GENEWRITER.TM. technology and purified by RP HPLC (Dionex, Germany). The purified oligonucleotides were then assembled into a full-length, double stranded cDNA fragment as described in U.S. Pat. No. 6,670,127 and U.S. Pat. No. 6,521,427.

The cDNA from the gene assembly process was cloned into the pET9d vector (Novagen, Madison, Wis.) into NcoI/XhoI sites using standard protocols. Mutagenesis targeting active site cysteine and surface sulfydryl changes was done using the QuikChange site-directed mutatgenesis kit (Stratagene, La Jolla, Calif.) using oligonucleotides shown in Table 1. Protein sequence alignments and the solved crystal structures of TEV NIa protease ((Allison et al., Virology 154:9-20, 1986; Phan et al., J. Biol. Chem. 277:50564-72, 2002) were used to estimate whether the unpaired cysteine residues in NIa protease were surface exposed. As they all appeared to be surface exposed, all were targeted for point mutations. As a first pass, all except the active site cysteine were changed to serine residues.

The cysteine residue at position 19 did not tolerate the serine substitution, as indicated by a lack of protein expression (see below). Consequently, position 19 was randomized using an NNK oligo in a QuikChange site-directed mutagenesis reaction using standard protocols. Variants with tolerated substitutions at residue 19 were identified by protein expression (see below). C151S active site substitutions were introduced into these variants as described above, to assess the differences in catalytic activity. Generated variants and their amino acid sequences are shown in Table 2. Exemplary cDNA sequences are shown for the wild type NIa (SEQ ID NO: 40) and for the following NIa variants: C151S (SEQ ID NO: 41), C19V/C110S/C181S/C211S (SEQ ID NO: 42), C19V/C110S/C151S/C181S/C211S (SEQ ID NO: 43), His6-WT (SEQ ID NO: 44), WT-His6 (SEQ ID NO: 45), C151S-His6 (SEQ ID NO: 46), C19V/C110S/C181S/C211S-His6 (SEQ ID NO: 47), and C19V/C110S/C151S/C181S/C211S-His6 (SEQ ID NO: 48).

TABLE-US-00001 TABLE 1 SEQ Oligo Sequence ID NO: PVAH6-5' CTAACCATGGGCTCTACCTCTATGTTCCGTGGTGTTCGTGACTACAA 49 PVAH6-3' GTTACTCGAGTTATTAATGGTGATGGTGATGGTGGGTAACCAGTTTAACGG 50 C151S-5' CTACCAAAGACGGTCAGAGCGGTTCTCCGATCGTTTC 51 C151S-3' GAAACGATCGGAGAACCGCTCTGACCGTCTTTGGTAG 52 C151A-5' CTCTACCAAAGAAGGTCACGCCGGTTCTCCGATCGTTTC 53 C151A-3' GAAACGATCGGAGAACCGGCGTGACCTTCTTTGGTAGAG 54 C19S-5' CCCGATCTCTTCTGTTATCAGCCAGCTGGAAAACGAATCTGAAGG 55 C19S-3' CCTTCAGATTCGTTTTCCAGCTGGCTGATAACAGAAGAGATCGGG 56 C110S-5' CGACCCACTCTGAAAAAGTTAGCCTGATCCTGACCAACTTCCAG 57 C110S-3' CTGGAAGTTGGTCAGGATCAGGCTAACTTTTTCAGAGTGGGTCG 58 C181S-5' CACCTCTAACTACTTCGCGAGCTTCCCGAAAGGTTTCACCG 59 C181S-3' CGGTGAAACCTTTCGGGAAGCTCGCGAAGTAGTTAGAGGTG 60 C211S-5' CAACGCGTCTAACGTTAGCTGGGGTTCTTTCCACCTG 61 C211S-3' CAGGTGGAAAGAACCCCAGCTAACGTTAGACGCGTTG 62 C19NNK-5' ACCCGATCTCTTCTGTTATCNNKCAGCTGGAAAACGAATCTGAAG 63 C19NNK-3' CTTCAGATTCGTTTTCCAGCTGMNNGATAACAGAAGAGATCGGGT 64

TABLE-US-00002 TABLE 2 NIa variant SEQ ID NO: DNA WT 1 40 C151S 2 41 C110S 3 C181S 4 C211S 5 C19S/C110S/C181S 6 C19S/C110S/C211S 7 C19S/C181S/C211S 8 C19S/C110S/C181S/C211S 9 C110S/C181S 10 C110S/C211S 11 C19A/C110S/C181S/C211S 12 C110S/C181S/C211S 13 C19D/C110S/C181S/C211S 14 C19E/C110S/C181S/C211S 15 C19F/C110S/C181S/C211S 16 C110S/C181S/C211S 17 C19H/C110S/C181S/C211S 18 C19I/C110S/C181S/C211S 19 C19K/C110S/C181S/C211S 20 C19L/C110S/C181S/C211S 21 C19M/C110S/C181S/C211S 22 C19N/C110S/C181S/C211S 23 C19P/C110S/C181S/C211S 24 C19Q/C110S/C181S/C211S 25 C19R/C110S/C181S/C211S 26 C19T/C110S/C181S/C211S 27 C19V/C110S/C181S/C211S 38* 42 C19W/C110S/C181S/C211S 29 C19Y/C110S/C181S/C211S 30 C110S/C151S/C181S/C211S 31 C181S/C211S 32 C19V/C110S/C151S/C181S/C211S 33 43 C151A 34 His6-WT 35 44 WT-His6 36 45 C151S-His6 37 46 C19V/C110S/C181S/C211S-His6 38 47 C19V/C110S/C151S/C181S/C211S-His6 39 48 *NIa variant has an amino acid sequence of residues 1-233 of SEQ ID NO: 38

Protein Expression

Plasmids encoding cDNAs for the NIa protease variants in Table 1 were transformed in BL21 cells and single colonies from the transformants cultured in LB media with 100 .mu.g/ml kanamycin at +37.degree. C. overnight. Induction took place when the cultures reached an OD600 of 0.6-0.8 with 1 mM IPTG, or by culturing the cells in TB auto-induction media (Overnight Express Autoinduction Media, EMD Biosciences, Gibbstown, N.J.). The cells were further cultured overnight at 25.degree. C. or 18.degree. C., centrifuged and stored at -80.degree. C. All NIa protease variants with a wild-type C19 residue expressed very well in all surface sulfhydryl change combinations explored (Table 3).

For the NNK library, the constructs were screened for soluble protein expression in TB auto induction media, as described above. A Western blot was run to analyze the expression of the NNK variants.

TABLE-US-00003 TABLE 3 Substitutions Plasmid Variant C19 C110 C181 C211 C151 Number Expression Activity His.sub.6-WT pDR1706 + + WT pDR2090 + + C151S S pDR2092 + + C151A A pDR2091 + C110S S pDR3385 + C181S S pDR3388 + C211S S pDR3390 + C19S/C110S/C181S S S S pDR3384 - C19S/C110S/C211S S S S pDR3383 - C19S/C181S/C211S S S S pDR3382 - C19S/C110S/C181S/C211S S S S S pDR2371 - C110S/C181S S S pDR3386 + C110S/C211S pDR3387 + C110S/C181S/C211S S S S pDR3202 + + C110S/C151S/C181S/C211S S S S S pDR3467 + + C181S/C211S S S pDR3389 + C19V/C110S/C181S/C211S V S S S pDR3217 + + C19V/C110S/C151S/C181S/C211S V S S S S pDR3466 + +

Although several of the position 19 NNK variants were detectable at low levels (variants I, K, L, M, R, S, T, W, Y, F, G and H substitutions) (1-2% of the wild-type NIa), the variant C19V was expressed at significantly higher level than any other variant, and at a level equivalent to the wild type NIa. Based on the information, the following variants were selected for further studies: WT, C151S, C110S/C181S/C211S, C110S/C151S/C181S/C211S, C19V/C110S/C181S/C211S and C19V/C110S/C151S/C181S/C211S.

Protein Purification

Protein purification was done using standard methods in the presence of a reducing agent, 2 mM TCEP. Briefly, cell pellets were resuspended in Buffer A (20 mM tris-HCl, pH 7.5, 500 mM NaCl, 2 mM TCEP) supplemented with 0.1 U/ml benzonase and 0.3 mg/ml lysozyme, soincated on ice, filtered, and the cleared lysates were loaded onto a 5 ml HisTrap HP (GE Biosciences, Piscataway, N.J.) column pre-equilibrated with buffer A using an AKTA Explorer purification system (GE Lifesciences, Piscataway, N.J.). Proteins were eluted using an imidazole step gradient of 50-500 mM imidazole in buffer A. Fractions were analyzed by SDS-PAGE and the fractions containing the protein of interest were pooled and concentrated and filtered, followed by further purification by size exclusion chromatography (SEC). Concentrated and clarified samples were loaded directly onto a Superdex75 SEC matrix (GE Lifesciences, Piscataway, N.J.) pre-equilibrated with buffer A and separated isocratically at a flow rate of 1 ml/min. Fractions were analyzed by SDS-PAGE and the fractions containing protein were pooled and tested for enzymatic activity. All purified variants expressed well and were purified to over 95% purity.

Some of the variants (C151A, C19V/C110S/C181S/C211S and C19V/C110S/C151S/C181S/C211S) were also purified in the absence of the reducing agent, 2 mM TCEP, in order to evaluate the effect of oxidizing environment to protein expression, stability, and activity. Only under reducing conditions does the C151A variant with 4 free surface sulfhydryls collapse to a predominantly single, monomeric species. However, the proteases with all surface sulfhydryls changes behave as monomeric proteins in the complete absence of reducing agent. This suggests that these changes provide a clear physical benefit while retaining catalytic activity (see below).

Substrate and Activity Determination

A wild-card recognition sequence, EXVXXQX (SEQ ID NO: 74), was used to search the polyprotein sequence of PVA to determine a consensus recognition sequence for the NIa protease. This was done independently of published work identifying the processing junction points within the PVA polyprotein (Mertis et al., J. General Virol., 83:1211-1221, 2002). Published and potential recognition sequences, as well as the consensus sequence determined in this study listed in Table 4. Synthetic peptides corresponding to select recognition sequences were synthesized using solid-phase peptide chemistry (Anaspec, San Jose, Calif.) and tested for cleavage by the wild type NIa protease. Reactions were performed in 20 mM tris-HCl, pH 8.0, 150 mM NaCl and 1 mM dithiothreitol (DTT) containing 5 .mu.M PVA NIa protease and 500 .mu.M peptide and were analyzed by reverse-phase HPLC and LC-MS.

Enzyme activity was also determined for each variant using a fusion substrate protein containing the NIa protease consensus recognition sequence, ENVTFQG (SEQ ID NO:65). The consensus sequence was engineered into a fusion protein and used as a substrate to assess the enzymatic activity for all PVA NIa protease variants. Since the sequence contained a consensus site for N-linked glycosylation (NVT), another sequence was explored, EAVTFQG (SEQ ID NO: 66), with equal success. These fusion proteins contained an N-terminal poly-histidine tag to facilitate purification, the PNIa protease consensus recognition sequence, an S-tag for sensitive detection of proteolytic cleavage and a highly soluble "filler" protein to facilitate soluble expression of the fusion substrate protein. This cassette was generated by amplifying the region between the 3' end of the thrombin cleavage site and the XhoI site in pET41 (Novagen), adding the recognition sequence and NdeI cloning site in the 5' primer and inserting into the NdeI and XhoI restriction sites of pET28 (Novagen). The "filler" proteins could then be inserted into the multiple cloning site pulled over from pET41. Polypeptide sequence of the fusion proteins with the ENVTFQG (SEQ ID NO: 65) and the EAVTFQG (SEQ ID NO: 66) consensus recognition sequences are shown in SEQ ID NOs: 67 and 68, respectively.

As fusion substrate controls, analogous constructs were generated with both TEV (Dougherty et al., Virology, 171:356-364, 1989) and TVMV NIa protease recognition sequences (Nallamsetty et al., Protein Expr. and Purific. 38:108-115, 2004) (Table 4). Analogous to human rhinovirus 3C (HRV3C) recognition sequence, a fusion protein with a P2' proline was also generated for the consensus sequence and tested as a substrate (Table 4). All recognition sequences were inserted into the fusion substrate protein, described above, including the published recognition sequences for TEV and TVMV proteases listed. Reactions were performed in 20 mM Tris-HCl, pH 8.0, 150 mM NaCl and 1 mM DTT and allowed to run overnight at 37.degree. C.

Although it has been shown that the substrate specificity of 3C-like proteases is very high (Tozer et al., The FEBS J. 272:514-523, 2004), NIa wild type protease was able to cleave the fusion substrate with the TVMV NIa protease recognition sequence, although at a much lower rate than the PVA NIa protease consensus sequence. However, the NIa wild type protease was unable to cleave either the TEV NIa protease recognition sequence or the PVA NIa protease consensus sequence with a P2' proline residue in this format, the latter suggesting some level of P2' specificity (Table 4).

TABLE-US-00004 TABLE 4 Junction* Recognition Sequence SEQ ID NO: Synthetic Peptide** SEQ ID NO: Cleaved by NIa P3/6K1 EVVLFQA{circumflex over ( )} 75 SEVVLFQASS 70 Yes 6K1/CI NTVQFQS 76 CI/6K2 EAVQFQS{circumflex over ( )} 77 6K2/VPg GVVAFQG 78 VPg/Pro ESVEFES 79 NIa/NIb EAVYTQG{circumflex over ( )} 80 SEAVYTQGSS 71 Yes NIb/cap DMVYFQA 81 NA ENVTKQL{circumflex over ( )} 82 SENVTKQLSS 87 No NA EMVTNQS{circumflex over ( )} 83 SEMVTNQSSS 88 No Consensus ENVTFQG 65 SENVTFQGSS 72 Yes ENVTFQGP 84 No TEV ENLYGQGS 85 No TVMV ETVRFQGS 86 Yes *As determined in Mertis et. al., 2002. {circumflex over ( )}Sequences that met the EXVXXQX search criteria and from which the consensus sequence peptide was generated *Synthetic peptide used in the assays

The wild type NIa protease and variants C151S, C110S/C181S/C211S, C110S/C151S/C181S/C211S, C19V/C110S/C181S/C211S and C19V/C110S/C151S/C181S/C211S were screened for activity against the fusion substrate protein with the ENVTFQG (SEQ ID NO: 66) consensus recognition site. Reaction conditions were identical to those described above. Proteolytic cleavage of the substrate was monitored by SDS-PAGE. Each NIa protease with an active site cysteine residue (WT, C110S/C181S/C211S, C19V/C110S/C181S/C211S) cleaved the substrate to completion under these conditions. The NIa protease active site variants (C151S, C110S/C151S/C181S/C211S, C19V/C110S/C151S/C181S/C211S) also cleaved the substrate, albeit with less efficiency (1-5% of substrate cleaved) when compared to the wild type NIa (data not shown).

Enzyme Kinetics

Wild-type NIa protease and active site and surface cysteine variants were tested for activity against the fluorophore/quencher substrate peptide 4-(4-dimethylaminophenylazo)benzoyl (DABCYL)--YGENVTFQGSK-5-[(2-aminoethyl)amino]naphthalene-1-sulfonic acid (EDANS) (SEQ ID NO: 73) (Anaspec, San Jose, Calif.). Kinetic measurements were performed on a Spectramax M2 microplate reader (Molecular Devices) using an excitation wavelength of 340 nm and emission wavelength of 490 nm. The reactions were performed in 50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA, 1 mM DTT with 2 mM enzyme and 0.1-300 M substrate and followed for 30 minutes at 37.degree. C. Enzyme concentrations were determined from the calculated theoretical extinction coefficient. Initial velocities were determined for each and are shown in Table 5.

TABLE-US-00005 TABLE 5 Relative Plasmid V.sub.max K.sub.m .degree. Variant Number DTT (RFU/min) (uM) K.sub.cat/K.sub.m WT pDR2090 + 78466 177.6 100 C151S pDR2092 + 3236 164.9 4.3 C110S/C181S/C211S pDR3202 + 51110 251.5 45.9 C110S/C151S/C181S/ pDR3467 + 2346 71.8 7.6 C211S C19V/C110S/C181S/ pDR3217 + 75184 275.4 59.5 C211S C19V/C110S/C151S/ pDR3466 + 1888 39.6 10.8 C181S/C211S C19V/C110S/C181S/ pDR3217 - 53847 175.4 69.1 C211S C19V/C110S/C151S/ pDR3466 - 1358 43.1 7.1 C181S/C211S

The substitutions to the surface exposed cysteine residues had a minor effect on catalytic activity of NIa protease, whereas substitutions at the active site cysteine (C151) reduced activity significantly. This can be explained by the inability of the substituted serine to donate its hydroxyl proton required for catalysis in the micro-environment within the active site, whereas deprotonation of cysteine readily occurs at physiological pH.

However, to determine whether having a reducing agent present during the purification process as well as during activity measurements impacted only molecules with an active site cysteine; two PVA NIa protease variants (C19V/C110S/C181S/C211S and C19V/C110S/C151S/C181S/C211S) were purified and assayed in the absence of reductant. The absence of reductant had little effect on the activity of either variant (Table 5). This suggests that the active site cysteine in these proteins may not be overly sensitive to an oxidizing environment and liability is predominantly due to the non-active site cysteine residues.

SEQUENCE LISTINGS

1

881233PRTPotato VirusNIa protease 1Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 2233PRTArtificial SequencePotato virus C151S Mutant 2Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Ser Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 3233PRTArtificial SequencePotato Virus C110S Mutant 3Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 4233PRTArtificial SequencePotato Virus C181S Mutant 4Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 5233PRTArtificial SequencePotato Virus C211S Mutant 5Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 6233PRTArtificial SequencePotato Virus C19S/C110S/C181S Mutant 6Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Ser Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 7233PRTArtificial SequencePotato Virus C19S/C110S/C211S Mutant 7Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Ser Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 8233PRTArtificial SequencePVA C19S/C181S/C211S mutant 8Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Ser Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 9233PRTArtificial SequencePVA Protease C19S/C110S/C181S/C211S mutant 9Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Ser Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 10233PRTArtificial SequencePVA Protease C110S/C181S mutant 10Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135

140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 11233PRTArtificial SequencePVA Protease C110S/C211S mutant 11Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 12233PRTArtificial SequencePVA Protease C19A/C110S/C181S/C211S mutant 12Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Ala Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 13233PRTArtificial SequencePVA Protease C110S/C181S/C211S mutant 13Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 14233PRTArtificial SequencePVA Protease C19D/C110S/C181S/C211S mutant 14Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Asp Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 15233PRTArtificial SequencePVA Protease C19E/C110S/C181S/C211S mutant 15Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Glu Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 16235PRTArtificial SequencePVA Protease C19F/C110S/C181S/C211S 16Met Gly Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile 1 5 10 15 Ser Ser Val Ile Phe Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr 20 25 30 Gln Leu Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His 35 40 45 Leu Phe Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly 50 55 60 Val Phe Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu65 70 75 80 Gly Arg Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe 85 90 95 Pro Gln Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser 100 105 110 Leu Ile Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser 115 120 125 Glu Thr Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His 130 135 140 Trp Ile Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr145 150 155 160 Thr Asp Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn 165 170 175 Thr Ser Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr 180 185 190 Leu Ala Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn 195 200 205 Ala Ser Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro 210 215 220 Thr Lys Glu Phe Lys Thr Val Lys Leu Val Thr225 230 235 17233PRTArtificial SequencePVA Protease C19G/C110S/C181S/C211S mutant 17Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Gly Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 18233PRTArtificial SequencePVA Protease C19H/C110S/C181S/C211S mutant 18Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile His Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 19233PRTArtificial SequencePVA Protease C19I/C110S/C181S/C211S mutant 19Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Ile Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 20233PRTArtificial SequencePVA Protease C19K/C110S/C181S/C211S mutant 20Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Lys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20

25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 21233PRTArtificial SequencePVA Protease C19L/C110S/C181S/C211S mutant 21Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Leu Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 22233PRTArtificial SequencePVA Protease C19M/C110S/C181S/C211S mutant 22Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Met Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 23233PRTArtificial SequencePVA Protease C19N/C110S/C181S/C211S mutant 23Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Asn Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 24156PRTArtificial SequencePVA Protease C19P/C110S/C181S/C211S mutant 24Glu Gly Arg Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro 1 5 10 15 Phe Pro Gln Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val 20 25 30 Ser Leu Ile Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val 35 40 45 Ser Glu Thr Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys 50 55 60 His Trp Ile Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser65 70 75 80 Thr Thr Asp Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr 85 90 95 Asn Thr Ser Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr 100 105 110 Tyr Leu Ala Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe 115 120 125 Asn Ala Ser Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys 130 135 140 Pro Thr Lys Glu Phe Lys Thr Val Lys Leu Val Thr145 150 155 25233PRTArtificial SequencePVA Protease C19Q/C110S/C181S/C211S mutant 25Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Gln Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 26233PRTArtificial SequencePVA Protease C19R/C110S/C181S/C211S mutant 26Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Arg Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 27233PRTArtificial SequencePVA Protease C19T/C110S/C181S/C211S mutant 27Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Thr Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 28156PRTArtificial SequencePVA Protease C19V/C110S/C181S/C211S mutant 28Glu Gly Arg Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro 1 5 10 15 Phe Pro Gln Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val 20 25 30 Ser Leu Ile Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val 35 40 45 Ser Glu Thr Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys 50 55 60 His Trp Ile Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser65 70 75 80 Thr Thr Asp Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr 85 90 95 Asn Thr Ser Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr 100 105 110 Tyr Leu Ala Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe 115 120 125 Asn Ala Ser Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys 130 135 140 Pro Thr Lys Glu Phe Lys Thr Val Lys Leu Val Thr145 150 155 29156PRTArtificial SequencePVA Protease C19W/C110S/C181S/C211S mutant 29Glu Gly Arg Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro 1 5 10 15 Phe Pro Gln Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val 20 25 30 Ser Leu Ile Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val 35 40 45 Ser Glu Thr Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys 50 55 60 His Trp Ile Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser65 70 75 80 Thr Thr Asp Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr 85 90 95 Asn Thr Ser Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr 100 105 110 Tyr Leu Ala Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe 115 120 125 Asn Ala Ser Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys 130 135 140 Pro Thr Lys Glu Phe Lys Thr Val Lys Leu Val Thr145 150 155 30156PRTArtificial SequencePVA Protease C19Y/C110S/C181S/C211S mutant 30Glu Gly Arg Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro 1 5 10 15 Phe Pro Gln Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val 20 25 30 Ser Leu Ile Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val 35 40 45 Ser Glu Thr Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys 50 55 60 His Trp Ile Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser65 70 75 80 Thr Thr Asp Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr 85 90 95 Asn Thr Ser Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr 100 105 110 Tyr Leu Ala Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe 115 120 125 Asn Ala Ser Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys 130 135 140

Pro Thr Lys Glu Phe Lys Thr Val Lys Leu Val Thr145 150 155 31233PRTArtificial SequencePVA Protease C110S/C151S/C181S/C211S Mutant 31Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Ser Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 32233PRTArtificial SequencePVA Protease C181S/C211S mutant 32Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 33156PRTArtificial SequencePVA Protease C19V/C110S/C151S/C181S/C211S mutant 33Glu Gly Arg Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro 1 5 10 15 Phe Pro Gln Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val 20 25 30 Ser Leu Ile Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val 35 40 45 Ser Glu Thr Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys 50 55 60 His Trp Ile Ser Thr Lys Glu Gly His Ser Gly Ser Pro Ile Val Ser65 70 75 80 Thr Thr Asp Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr 85 90 95 Asn Thr Ser Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr 100 105 110 Tyr Leu Ala Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe 115 120 125 Asn Ala Ser Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys 130 135 140 Pro Thr Lys Glu Phe Lys Thr Val Lys Leu Val Thr145 150 155 34233PRTArtificial SequencePVA Protease C151A mutant 34Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Ala Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr225 230 35241PRTArtificial SequencePVA Protease with N-terminal 6x-His tag 35Met Gly His His His His His His Ser Thr Ser Met Phe Arg Gly Val 1 5 10 15 Arg Asp Tyr Asn Pro Ile Ser Ser Val Ile Cys Gln Leu Glu Asn Glu 20 25 30 Ser Glu Gly Arg Thr Thr Gln Leu Phe Gly Leu Gly Phe Gly Pro Phe 35 40 45 Ile Ile Thr Asn Gln His Leu Phe Val Arg Asn Asn Gly Ser Leu Thr 50 55 60 Val Arg Ser Gln Met Gly Val Phe Lys Val Asn Ser Thr Val Thr Leu65 70 75 80 Gln Met Arg Pro Val Glu Gly Arg Asp Val Leu Ile Ile Lys Met Pro 85 90 95 Lys Asp Phe Pro Pro Phe Pro Gln Arg Leu Lys Phe Arg Gln Pro Thr 100 105 110 His Ser Glu Lys Val Cys Leu Ile Leu Thr Asn Phe Gln Gln Lys Ser 115 120 125 Ser Ser Ser Met Val Ser Glu Thr Ser His Ile Ile Pro Lys Glu Asn 130 135 140 Thr Tyr Phe Trp Lys His Trp Ile Ser Thr Lys Glu Gly His Cys Gly145 150 155 160 Ser Pro Ile Val Ser Thr Thr Asp Gly Ala Ile Leu Gly Ile His Ser 165 170 175 Leu Ser Asn Met Thr Asn Thr Ser Asn Tyr Phe Ala Cys Phe Pro Lys 180 185 190 Gly Phe Thr Glu Thr Tyr Leu Ala Thr Glu Ser Ala His Glu Trp Val 195 200 205 Lys Gly Trp Lys Phe Asn Ala Ser Asn Val Cys Trp Gly Ser Phe His 210 215 220 Leu Gln Asp Ser Lys Pro Thr Lys Glu Phe Lys Thr Val Lys Leu Val225 230 235 240 Thr36239PRTArtificial SequencePVA Protease with C-terminal 6x-His tag 36Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr His His His His His His225 230 235 37239PRTArtificial SequencePVA C151S Protease with C-terminal 6x-His tag 37Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Cys Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Ser Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr His His His His His His225 230 235 38239PRTArtificial SequencePVA Protease C19V/C110S/C181S/C211S with C-terminal 6x-His tag 38Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Val Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr His His His His His His225 230 235 39239PRTArtificial SequencePVA Protease C19V/C110S/C151S/C181S/C211S with C-terminal 6x-His tag 39Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 10 15 Val Ile Val Gln Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 20 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn Gln His Leu Phe 35 40 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg65 70 75 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 85 90 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Ser Gly Ser Pro Ile Val Ser Thr Thr Asp145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Ser Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Ser Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr His His His His His His225 230 235 40699DNAPotato VirusNIa protease 40tctacctcta tgttccgtgg tgttcgtgac tacaacccga tctcttctgt tatctgccag 60ctggaaaacg aatctgaagg tcgtaccacc cagctgttcg gtctgggttt cggtccgttc 120atcatcacca accagcacct gttcgttcgt aacaacggtt ctctgaccgt tcgttctcag 180atgggtgttt tcaaagttaa ctctaccgtt accctgcaga tgcgtccggt tgaaggtcgt 240gacgttctga tcatcaaaat gccgaaagac ttcccgccgt tcccgcagcg tctgaaattc 300cgtcagccga cccactctga aaaagtttgc ctgatcctga ccaacttcca gcagaaatct 360tcttcttcta tggtttctga aacctctcac atcatcccga aagaaaacac ctacttctgg 420aaacactgga tctctaccaa agaaggtcac tgcggttctc cgatcgtttc taccaccgac 480ggtgcgatcc tgggtatcca ctctctgtct aacatgacca acacctctaa ctacttcgcg 540tgcttcccga aaggtttcac cgaaacctac ctggcgaccg aatctgcgca cgaatgggtt 600aaaggttgga aattcaacgc gtctaacgtt tgctggggtt ctttccacct gcaggactct 660aaaccgacca aagaattcaa aaccgttaaa ctggttacc 69941699DNAArtificial SequencePVA C151S mutant 41tctacctcta tgttccgtgg tgttcgtgac tacaacccga tctcttctgt tatctgccag 60ctggaaaacg aatctgaagg tcgtaccacc cagctgttcg gtctgggttt cggtccgttc 120atcatcacca accagcacct gttcgttcgt aacaacggtt ctctgaccgt tcgttctcag 180atgggtgttt tcaaagttaa ctctaccgtt accctgcaga tgcgtccggt

tgaaggtcgt 240gacgttctga tcatcaaaat gccgaaagac ttcccgccgt tcccgcagcg tctgaaattc 300cgtcagccga cccactctga aaaagtttgc ctgatcctga ccaacttcca gcagaaatct 360tcttcttcta tggtttctga aacctctcac atcatcccga aagaaaacac ctacttctgg 420aaacactgga tctctaccaa agaaggtcac agcggttctc cgatcgtttc taccaccgac 480ggtgcgatcc tgggtatcca ctctctgtct aacatgacca acacctctaa ctacttcgcg 540tgcttcccga aaggtttcac cgaaacctac ctggcgaccg aatctgcgca cgaatgggtt 600aaaggttgga aattcaacgc gtctaacgtt tgctggggtt ctttccacct gcaggactct 660aaaccgacca aagaattcaa aaccgttaaa ctggttacc 69942699DNAArtificial SequencePVA Protease C19V/C110S/C181S/C211S mutant 42tctacctcta tgttccgtgg tgttcgtgac tacaacccga tctcttctgt tatcgttcag 60ctggaaaacg aatctgaagg tcgtaccacc cagctgttcg gtctgggttt cggtccgttc 120atcatcacca accagcacct gttcgttcgt aacaacggtt ctctgaccgt tcgttctcag 180atgggtgttt tcaaagttaa ctctaccgtt accctgcaga tgcgtccggt tgaaggtcgt 240gacgttctga tcatcaaaat gccgaaagac ttcccgccgt tcccgcagcg tctgaaattc 300cgtcagccga cccactctga aaaagttagc ctgatcctga ccaacttcca gcagaaatct 360tcttcttcta tggtttctga aacctctcac atcatcccga aagaaaacac ctacttctgg 420aaacactgga tctctaccaa agaaggtcac tgcggttctc cgatcgtttc taccaccgac 480ggtgcgatcc tgggtatcca ctctctgtct aacatgacca acacctctaa ctacttcgcg 540agcttcccga aaggtttcac cgaaacctac ctggcgaccg aatctgcgca cgaatgggtt 600aaaggttgga aattcaacgc gtctaacgtt agctggggtt ctttccacct gcaggactct 660aaaccgacca aagaattcaa aaccgttaaa ctggttacc 69943699DNAArtificial SequencePVA Protease C19V/C110S/C151S/C181S/C211S mutant 43tctacctcta tgttccgtgg tgttcgtgac tacaacccga tctcttctgt tatcgttcag 60ctggaaaacg aatctgaagg tcgtaccacc cagctgttcg gtctgggttt cggtccgttc 120atcatcacca accagcacct gttcgttcgt aacaacggtt ctctgaccgt tcgttctcag 180atgggtgttt tcaaagttaa ctctaccgtt accctgcaga tgcgtccggt tgaaggtcgt 240gacgttctga tcatcaaaat gccgaaagac ttcccgccgt tcccgcagcg tctgaaattc 300cgtcagccga cccactctga aaaagttagc ctgatcctga ccaacttcca gcagaaatct 360tcttcttcta tggtttctga aacctctcac atcatcccga aagaaaacac ctacttctgg 420aaacactgga tctctaccaa agaaggtcac agcggttctc cgatcgtttc taccaccgac 480ggtgcgatcc tgggtatcca ctctctgtct aacatgacca acacctctaa ctacttcgcg 540agcttcccga aaggtttcac cgaaacctac ctggcgaccg aatctgcgca cgaatgggtt 600aaaggttgga aattcaacgc gtctaacgtt agctggggtt ctttccacct gcaggactct 660aaaccgacca aagaattcaa aaccgttaaa ctggttacc 69944723DNAArtificial SequencePVA Protease with N-terminal 6x-His tag 44atgggccacc atcaccatca ccattctacc tctatgttcc gtggtgttcg tgactacaac 60ccgatctctt ctgttatctg ccagctggaa aacgaatctg aaggtcgtac cacccagctg 120ttcggtctgg gtttcggtcc gttcatcatc accaaccagc acctgttcgt tcgtaacaac 180ggttctctga ccgttcgttc tcagatgggt gttttcaaag ttaactctac cgttaccctg 240cagatgcgtc cggttgaagg tcgtgacgtt ctgatcatca aaatgccgaa agacttcccg 300ccgttcccgc agcgtctgaa attccgtcag ccgacccact ctgaaaaagt ttgcctgatc 360ctgaccaact tccagcagaa atcttcttct tctatggttt ctgaaacctc tcacatcatc 420ccgaaagaaa acacctactt ctggaaacac tggatctcta ccaaagaagg tcactgcggt 480tctccgatcg tttctaccac cgacggtgcg atcctgggta tccactctct gtctaacatg 540accaacacct ctaactactt cgcgtgcttc ccgaaaggtt tcaccgaaac ctacctggcg 600accgaatctg cgcacgaatg ggttaaaggt tggaaattca acgcgtctaa cgtttgctgg 660ggttctttcc acctgcagga ctctaaaccg accaaagaat tcaaaaccgt taaactggtt 720acc 72345717DNAArtificial SequencePVA Protease with C-terminal 6x-His tag 45tctacctcta tgttccgtgg tgttcgtgac tacaacccga tctcttctgt tatctgccag 60ctggaaaacg aatctgaagg tcgtaccacc cagctgttcg gtctgggttt cggtccgttc 120atcatcacca accagcacct gttcgttcgt aacaacggtt ctctgaccgt tcgttctcag 180atgggtgttt tcaaagttaa ctctaccgtt accctgcaga tgcgtccggt tgaaggtcgt 240gacgttctga tcatcaaaat gccgaaagac ttcccgccgt tcccgcagcg tctgaaattc 300cgtcagccga cccactctga aaaagtttgc ctgatcctga ccaacttcca gcagaaatct 360tcttcttcta tggtttctga aacctctcac atcatcccga aagaaaacac ctacttctgg 420aaacactgga tctctaccaa agaaggtcac tgcggttctc cgatcgtttc taccaccgac 480ggtgcgatcc tgggtatcca ctctctgtct aacatgacca acacctctaa ctacttcgcg 540tgcttcccga aaggtttcac cgaaacctac ctggcgaccg aatctgcgca cgaatgggtt 600aaaggttgga aattcaacgc gtctaacgtt tgctggggtt ctttccacct gcaggactct 660aaaccgacca aagaattcaa aaccgttaaa ctggttaccc accatcacca tcaccat 71746717DNAArtificial SequencePVA C151S mutant with C-terminal 6x-His tag 46tctacctcta tgttccgtgg tgttcgtgac tacaacccga tctcttctgt tatctgccag 60ctggaaaacg aatctgaagg tcgtaccacc cagctgttcg gtctgggttt cggtccgttc 120atcatcacca accagcacct gttcgttcgt aacaacggtt ctctgaccgt tcgttctcag 180atgggtgttt tcaaagttaa ctctaccgtt accctgcaga tgcgtccggt tgaaggtcgt 240gacgttctga tcatcaaaat gccgaaagac ttcccgccgt tcccgcagcg tctgaaattc 300cgtcagccga cccactctga aaaagtttgc ctgatcctga ccaacttcca gcagaaatct 360tcttcttcta tggtttctga aacctctcac atcatcccga aagaaaacac ctacttctgg 420aaacactgga tctctaccaa agaaggtcac agcggttctc cgatcgtttc taccaccgac 480ggtgcgatcc tgggtatcca ctctctgtct aacatgacca acacctctaa ctacttcgcg 540tgcttcccga aaggtttcac cgaaacctac ctggcgaccg aatctgcgca cgaatgggtt 600aaaggttgga aattcaacgc gtctaacgtt tgctggggtt ctttccacct gcaggactct 660aaaccgacca aagaattcaa aaccgttaaa ctggttaccc accatcacca tcaccat 71747723DNAArtificial SequencePVA Protease C19V/C110S/C181S/C211S mutant with C-terminal 6x-His tag 47atgggctcta cctctatgtt ccgtggtgtt cgtgactaca acccgatctc ttctgttatc 60gttcagctgg aaaacgaatc tgaaggtcgt accacccagc tgttcggtct gggtttcggt 120ccgttcatca tcaccaacca gcacctgttc gttcgtaaca acggttctct gaccgttcgt 180tctcagatgg gtgttttcaa agttaactct accgttaccc tgcagatgcg tccggttgaa 240ggtcgtgacg ttctgatcat caaaatgccg aaagacttcc cgccgttccc gcagcgtctg 300aaattccgtc agccgaccca ctctgaaaaa gttagcctga tcctgaccaa cttccagcag 360aaatcttctt cttctatggt ttctgaaacc tctcacatca tcccgaaaga aaacacctac 420ttctggaaac actggatctc taccaaagaa ggtcactgcg gttctccgat cgtttctacc 480accgacggtg cgatcctggg tatccactct ctgtctaaca tgaccaacac ctctaactac 540ttcgcgagct tcccgaaagg tttcaccgaa acctacctgg cgaccgaatc tgcgcacgaa 600tgggttaaag gttggaaatt caacgcgtct aacgttagct ggggttcttt ccacctgcag 660gactctaaac cgaccaaaga attcaaaacc gttaaactgg ttacccacca tcaccatcac 720cat 72348717DNAArtificial SequencePVA Protease C19V/C110S/C151S/C181S/C211S mutant with C-terminal 6x-His tag 48tctacctcta tgttccgtgg tgttcgtgac tacaacccga tctcttctgt tatcgttcag 60ctggaaaacg aatctgaagg tcgtaccacc cagctgttcg gtctgggttt cggtccgttc 120atcatcacca accagcacct gttcgttcgt aacaacggtt ctctgaccgt tcgttctcag 180atgggtgttt tcaaagttaa ctctaccgtt accctgcaga tgcgtccggt tgaaggtcgt 240gacgttctga tcatcaaaat gccgaaagac ttcccgccgt tcccgcagcg tctgaaattc 300cgtcagccga cccactctga aaaagttagc ctgatcctga ccaacttcca gcagaaatct 360tcttcttcta tggtttctga aacctctcac atcatcccga aagaaaacac ctacttctgg 420aaacactgga tctctaccaa agaaggtcac agcggttctc cgatcgtttc taccaccgac 480ggtgcgatcc tgggtatcca ctctctgtct aacatgacca acacctctaa ctacttcgcg 540agcttcccga aaggtttcac cgaaacctac ctggcgaccg aatctgcgca cgaatgggtt 600aaaggttgga aattcaacgc gtctaacgtt agctggggtt ctttccacct gcaggactct 660aaaccgacca aagaattcaa aaccgttaaa ctggttaccc accatcacca tcaccat 7174947DNAArtificial Sequencemutagenesis primer 49ctaaccatgg gctctacctc tatgttccgt ggtgttcgtg actacaa 475051DNAArtificial Sequencemutagenesis primer 50gttactcgag ttattaatgg tgatggtgat ggtgggtaac cagtttaacg g 515137DNAArtificial Sequencemutagenesis primer 51ctaccaaaga cggtcagagc ggttctccga tcgtttc 375237DNAArtificial Sequencemutagenesis primer 52gaaacgatcg gagaaccgct ctgaccgtct ttggtag 375339DNAArtificial Sequencemutagenesis primer 53ctctaccaaa gaaggtcacg ccggttctcc gatcgtttc 395439DNAArtificial Sequencemutagenesis primer 54gaaacgatcg gagaaccggc gtgaccttct ttggtagag 395545DNAArtificial Sequencemutagenesis primer 55cccgatctct tctgttatca gccagctgga aaacgaatct gaagg 455645DNAArtificial Sequencemutagenesis primer 56ccttcagatt cgttttccag ctggctgata acagaagaga tcggg 455744DNAArtificial Sequencemutagenesis primer 57cgacccactc tgaaaaagtt agcctgatcc tgaccaactt ccag 445844DNAArtificial Sequencemutagenesis primer 58ctggaagttg gtcaggatca ggctaacttt ttcagagtgg gtcg 445941DNAArtificial Sequencemutagenesis primer 59cacctctaac tacttcgcga gcttcccgaa aggtttcacc g 416041DNAArtificial Sequencemutagenesis primer 60cggtgaaacc tttcgggaag ctcgcgaagt agttagaggt g 416137DNAArtificial Sequencemutagenesis primer 61caacgcgtct aacgttagct ggggttcttt ccacctg 376237DNAArtificial Sequencemutagenesis primer 62caggtggaaa gaaccccagc taacgttaga cgcgttg 376345DNAArtificial Sequencemutagenesis primer 63acccgatctc ttctgttatc nnkcagctgg aaaacgaatc tgaag 456445DNAArtificial Sequencemutagenesis primer 64cttcagattc gttttccagc tgmnngataa cagaagagat cgggt 45657PRTArtificial SequenceConsensus NIa cleavage site, has N-glycosylation site 65Glu Asn Val Thr Phe Gln Gly 1 5 667PRTArtificial SequenceConsensus NIa cleavage site without N-glycosylation site 66Glu Asn Val Thr Phe Gln Gly 1 5 67145PRTArtificial SequenceNIa protease fusion substrate with ENVTFQG recognition site 67Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro 1 5 10 15 Arg Gly Ser His Met Thr Thr Glu Asn Val Thr Phe Gln Gly Ser Thr 20 25 30 Ala Ile Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln His 35 40 45 Met Asp Ser Pro Asp Leu Gly Thr Leu Pro Ala Pro Lys Asn Leu Val 50 55 60 Val Ser Glu Val Thr Glu Asp Ser Leu Arg Leu Ser Trp Thr Ala Pro65 70 75 80 Asp Ala Ala Phe Asp Ser Phe Leu Ile Gln Tyr Gln Glu Ser Glu Lys 85 90 95 Val Gly Glu Ala Ile Asn Leu Thr Val Pro Gly Ser Glu Arg Ser Tyr 100 105 110 Asp Leu Thr Gly Leu Lys Pro Gly Thr Glu Tyr Thr Val Ser Ile Tyr 115 120 125 Gly Val Lys Gly Gly His Arg Ser Asn Pro Leu Ser Ala Glu Phe Thr 130 135 140 Thr145 68146PRTArtificial SequenceNIa protease fusion substrate with EAVTFQG recognition site 68Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro 1 5 10 15 Arg Gly Ser His Met Thr Thr Glu Ala Val Thr Phe Gln Gly Ser Thr 20 25 30 Ala Ile Gly Met Lys Glu Thr Ala Ala Ala Lys Phe Glu Arg Gln His 35 40 45 Met Asp Ser Pro Asp Leu Gly Thr Met Leu Pro Ala Pro Lys Asn Leu 50 55 60 Val Val Ser Glu Val Thr Glu Asp Ser Leu Arg Leu Ser Trp Thr Ala65 70 75 80 Pro Asp Ala Ala Phe Asp Ser Phe Leu Ile Gln Tyr Gln Glu Ser Glu 85 90 95 Lys Val Gly Glu Ala Ile Asn Leu Thr Val Pro Gly Ser Glu Arg Ser 100 105 110 Tyr Asp Leu Thr Gly Leu Lys Pro Gly Thr Glu Tyr Thr Val Ser Ile 115 120 125 Tyr Gly Val Lys Gly Gly His Arg Ser Asn Pro Leu Ser Ala Glu Phe 130 135 140 Thr Thr145 696PRTArtificial SequenceNIa proteases P6-P1 recognition sequence 69Glu Xaa Xaa Tyr Xaa Gln 1 5 7010PRTArtificial SequenceSynthetic peptide 70Ser Glu Val Val Leu Phe Gln Ala Ser Ser 1 5 10 7110PRTArtificial SequenceSynthetic peptide 71Ser Glu Ala Val Tyr Thr Gln Gly Ser Ser 1 5 10 7210PRTArtificial SequenceSynthetic peptide 72Ser Glu Asn Val Thr Phe Gln Gly Ser Ser 1 5 10 7311PRTArtificial SequenceSynthetic peptide 73Tyr Gly Glu Asn Val Thr Phe Gln Gly Ser Lys 1 5 10 747PRTArtificial SequenceSynthetic peptide 74Glu Xaa Val Xaa Xaa Gln Xaa 1 5 757PRTArtificial SequenceSynthetic peptide 75Glu Val Val Leu Phe Gln Ala 1 5 767PRTArtificial SequenceSynthetic peptide 76Asn Thr Val Gln Phe Gln Ser 1 5 777PRTArtificial SequenceSynthetic peptide 77Glu Ala Val Gln Phe Gln Ser 1 5 787PRTArtificial SequenceSynthetic peptide 78Gly Val Val Ala Phe Gln Gly 1 5 797PRTArtificial SequenceSynthetic peptide 79Glu Ser Val Glu Phe Glu Ser 1 5 807PRTArtificial SequenceSynthetic peptide 80Glu Ala Val Tyr Thr Gln Gly 1 5 817PRTArtificial SequenceSynthetic peptide 81Asp Met Val Tyr Phe Gln Ala 1 5 827PRTArtificial SequenceSynthetic peptide 82Glu Asn Val Thr Lys Gln Leu 1 5 837PRTArtificial SequenceSynthetic peptide 83Glu Met Val Thr Asn Gln Ser 1 5 848PRTArtificial SequenceSynthetic peptide 84Glu Asn Val Thr Phe Gln Gly Pro 1 5 858PRTArtificial SequenceSynthetic peptide 85Glu Asn Leu Tyr Gly Gln Gly Ser 1 5 868PRTArtificial SequenceSynthetic peptide 86Glu Thr Val Arg Phe Gln Gly Ser 1 5 8710PRTArtificial SequenceSynthetic peptide 87Ser Glu Asn Val Thr Lys Gln Leu Ser Ser 1 5 10 8810PRTArtificial SequenceSynthetic peptide 88Ser Glu Met Val Thr Asn Gln Ser Ser Ser 1 5 10

科学支持的最完整的草药数据库

  • 支持55种语言
  • 科学支持的草药疗法
  • 通过图像识别草药
  • 交互式GPS地图-在位置标记草药(即将推出)
  • 阅读与您的搜索相关的科学出版物
  • 通过药效搜索药草
  • 组织您的兴趣并及时了解新闻研究,临床试验和专利

输入症状或疾病,并阅读可能有用的草药,输入草药并查看所使用的疾病和症状。
*所有信息均基于已发表的科学研究

Google Play badgeApp Store badge