Soluble tumor necrosis factor receptor mutant
关键词
专利信息
专利号 | 8454969 |
已提起 | 01/11/2009 |
专利日期 | 06/03/2013 |
抽象
索偿
The invention claimed is:
1. A soluble TNFRp75 mutant comprising N-terminal 257 amino acid residues of TNFRp75, the amino acid sequence of TNFRp75 being set forth in SEQ ID NO. 1, wherein an N-terminal residue Glu92 of the amino acid sequence set forth in SEQ ID NO. 1 is substituted in the mutant.
2. The soluble TNFRp75 mutant of claim 1, wherein the N-terminal residue Glu92 of the amino acid sequence set forth in SEQ ID NO. 1 is substituted by one of Asn, His, Ser, Ala, Lys or Gln.
3. The soluble TNFRp75 mutant of claim 1, wherein the N-terminal residue Trp89 of the amino acid sequence set forth in SEQ ID NO. 1 is substituted in the mutant.
4. The soluble TNFRp75 mutant of claim 3, wherein the N-terminal residue Glu92 of the amino acid sequence set forth in SEQ ID NO. 1 is substituted by one of Asn, His, Ser, Ala, Lys or Gln; and in addition, the N-terminal residue Trp89 of the amino acid sequence set forth in SEQ ID NO. 1 is substituted by one of Tyr, Phe, His, Lys, Met, and Leu.
5. A fusion protein formed between the soluble TNFRp75 mutant of claim 1 and human immunoglobulin constant region, wherein the immunoglobulin constant region is at the C-terminus of the soluble TNFRp75 mutant.
6. The fusion protein of claim 5, wherein said additional amino acid fragment is the 232 amino acid residues of human immunoglobulin constant region.
7. A DNA sequence encoding a soluble TNFRp75 mutant wherein the soluble TNFRp75 mutant comprises the N-terminal 257 amino acid residues of TNFRp75, the amino acid sequence of TNFRp75 being set forth in SEQ ID NO. 1, wherein the N-terminal residue Glu92 of the amino acid sequence set forth in SEQ ID NO. 1 is substituted in the mutant.
8. A DNA sequence encoding a soluble TNFRp75 mutant-human Ig constant region fusion protein, wherein the DNA sequence comprises the DNA sequence of claim 7 and a DNA sequence encoding a human immunoglobulin constant region, wherein the immunoglobulin constant region is at the C-terminus of the soluble TNFRp75 mutant.
9. A method for treating rheumatoid arthritis, psoriasis, scleroderma, ankylosing spondylitis, or dermatomyositis, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of the soluble TNFRp75 mutant of claim 1.
10. A pharmaceutical composition comprising a therapeutically effective amount of the soluble TNFRp75 mutant of claim 1 and a pharmaceutically acceptable carrier.
11. A method for treating rheumatoid arthritis, psoriasis, scleroderma, ankylosing spondylitis, or dermatomyositis, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of the fusion protein of claim 5.
12. A pharmaceutical composition comprising a therapeutically effective amount of the fusion protein of claim 5 and a pharmaceutically acceptable carrier.
13. A fusion protein formed between the soluble TNFRp75 mutant of claim 2 and human immunoglobulin constant region, wherein the immunoglobulin constant region is at the C-terminus of the soluble TNFRp75 mutant.
14. A fusion protein formed between the soluble TNFRp75 mutant of claim 3 and human immunoglobulin constant region, wherein the immunoglobulin constant region is at the C-terminus of the soluble TNFRp75 mutant.
15. A fusion protein formed between the soluble TNFRp75 mutant of claim 4 and human immunoglobulin constant region, wherein the immunoglobulin constant region is at the C-terminus of the soluble TNFRp75 mutant.
16. The DNA sequence of claim 7 wherein the N-terminal residue Glu92 of the amino acid sequence set forth in SEQ ID NO. 1 is substituted by one of Asn, His, Ser, Ala, Lys or Gln.
17. A method for treating rheumatoid arthritis, psoriasis, scleroderma, ankylosing spondylitis, or dermatomyositis, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of the soluble TNFRp75 mutant of claim 2.
18. A pharmaceutical composition comprising a therapeutically effective amount of the soluble TNFRp75 mutant of claim 2 and a pharmaceutically acceptable carrier.
19. A method for treating rheumatoid arthritis, psoriasis, scleroderma, ankylosing spondylitis, or dermatomyositis, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of the fusion protein of claim 6.
20. A method for treating rheumatoid arthritis, psoriasis, scleroderma, ankylosing spondylitis, or dermatomyositis, wherein the method comprises administering to a subject in need thereof a therapeutically effective amount of the soluble TNFRp75 mutant of claim 3.
描述
CROSS-REFERENCE TO RELATED APPLICATIONS
This is the U.S. national phase of International Application No. PCT/CN2009/000037, filed Jan. 12, 2009, which claims the benefit of Chinese Patent Application No. 200810038410.X, filed May 30, 2008.
TECHNICAL FIELD
The present invention is in the field of biopharmaceuticals, and more particularly, it relates to derivatives of the tumor necrosis factor (TNF) receptor and use thereof in pharmaceuticals.
BACKGROUND OF THE INVENTION
The tumor necrosis factor .alpha. (TNF.alpha.) a member of the tumor necrosis factor superfamily, has biological activities of modulating immunological response, cell apoptosis, cell differentiation, and the like. TNF.alpha. has two intracellular receptors, TNF receptor 1 (TNFRp55) and TNF receptor 2 (TNFRp75). Overproduction of TNF.alpha. is an underlying mechanism of autoimmune diseases such as rheumatoid arthritis. Blocking excess TNFa by its antagonists including soluble TNFRp75:Fc fusion proteins such as Etanercept and anti-TNF monoclonal antibodies such as Infliximab has been validated as an effective treatment for rheumatoid arthritis.
Etanercept can bind both TNF.alpha. and lymphotoxin (LT), but it requires a relatively large clinical dose at about 25-50 mg, which tends to cause erythema when administered via subcutaneous injection. Therefore, it is highly demanded to develop a TNFRp75 which can bind TNF and lymphotoxin with high affinity, and in turn to develop a TNFRp75:Fc fusion protein as an antibody drug.
SUMMARY OF THE INVENTION
One of the objectives of the present invention is to provide a soluble receptor having a high neutralizing activity to TNF.alpha. and/or lymphotoxin, thereby reducing dose of the soluble receptor required for neutralizing TNF.alpha., improving therapeutic effect on autoimmune diseases and decreasing production cost of the drug.
Another objective of the present invention is to provide a fusion protein formed between a soluble receptor having a higher neutralizing activity and an additional amino acid fragment.
Still another objective of the present invention is to provide a DNA sequence encoding the soluble receptor or the fusion protein stated above.
Still another objective of the present invention is to provide use of a soluble receptor having a higher neutralizing activity to TNF.alpha. and/or lymphotoxin or a fusion protein thereof in pharmaceuticals.
Still another objective of the present invention is to provide a pharmaceutical composition comprising the soluble receptor or a fusion protein thereof stated above.
Inventors of the present invention have made intensive studies on the structures of TNF receptor 2, TNF.alpha. and LT through molecular structure modeling and found that the amino acid at position 92 of the TNF receptor 2 is essential for its binding with TNF.alpha. and LT. Then, the inventors made a rational point mutation at the amino acid position 92 and obtained a soluble mutant of TNF receptor 2, which has a high neutralizing activity to TNF.alpha. and lymphotoxin.
In the first aspect, the present invention discloses a soluble TNFRp75 mutant that has an amino acid substitution at the amino acid position 92 of the wild-type sequence (SEQ ID NO. 1). The neutralizing activity of the soluble TNFRp75 mutant against the cytotoxicity of TNF.alpha. and lymphotoxin is increased by above 30% when compared with the wild type.
In a preferred embodiment, the glutamic acid residue (E) at the amino acid position 92 is substituted by one of Asn, His, Ser, Ala, Lys or Gln. That is, the amino acid E at position 92 of the sequence set forth in SEQ ID NO. 1 is substituted by N, H, S, A, K or Q, respectively. The exemplary examples are as follows.
The amino acid sequence of TNFRp75 (E92H) mutant is set forth in SEQ ID NO. 2, wherein the position 92 is Histidine (His), and the N-terminal amino acid residues 1-22 are a signal peptide.
The amino acid sequence of TNFRp75 (E92A) mutant is set forth in SEQ ID NO. 3, wherein the position 92 is Alanine (Ala), and the N-terminal amino acid residues 1-22 are a signal peptide.
The amino acid sequence of TNFRp75 (E92N) mutant is set forth in SEQ ID NO. 4, wherein the position 92 is Asparagine (Asn), and the N-terminal amino acid residues 1-22 are a signal peptide.
The amino acid sequence of TNFRp75 (E92S) mutant is set forth in SEQ ID NO. 5, wherein the position 92 is Serine (Ser), and the N-terminal amino acid residues 1-22 are a signal peptide.
In some preferred embodiments, the Tryptophan (Trp) at position 89 is further substituted by Tyr, Phe, His, Lys, Met or Leu, in addition to the substitution of Glu (E) at position 92. The exemplary examples are as follows.
The amino acid sequence of TNFRp75 (E92N, W89Y) mutant is set forth in SEQ ID NO. 6, wherein the position 89 is Tyrosine (Tyr), position 92 is Asparagine (Asn), and the N-terminal amino acid residues 1-22 are a signal peptide.
The amino acid sequence of TNFRp75 (E92S, W89Y) mutant is set forth in SEQ ID NO. 7, wherein the position 89 is Tyrosine (Tyr), position 92 is Serine (Ser), and the N-terminal amino acid residues 1-22 are a signal peptide.
The amino acid sequence of TNFRp75 (E92N, W89F) mutant is set forth in SEQ ID NO. 8, wherein the position 89 is Phenylalanine (Phe), position 92 is Asparagine (Asn), and the N-terminal amino acid residues 1-22 are a signal peptide.
In the second aspect, the present invention discloses a fusion protein comprising a soluble TNFRp75 mutant and an additional amino acid fragment. Said additional amino acid fragment acts to enhance the stability and improve the biological half-life of the TNFRp75 mutant.
Said additional amino acid fragment is selected from the group consisting of the human immunoglobulin (IgG) constant region (Fc) and one of the five functional regions of Albumin.
Said additional amino acid fragment is at the C-terminus of the TNFRp75 mutant.
In a preferred embodiment, said additional amino acid fragment is the 232 amino acid residues of human immunoglobulin (IgG) constant region (Fc). A fusion protein is formed by the soluble TNFRp75 mutant and the 232 amino acids of the Fc fragment at the C-terminus of human IgG, with or without an additional connecting fragment between the two components, preferably without an additional connecting fragment. The exemplary examples are as follows:
the amino acid sequence of TNFRp75 (E92H): Fc set forth in SEQ ID NO. 9;
the amino acid sequence of TNFRp75 (E92A): Fc set forth in SEQ ID NO. 10;
the amino acid sequence of TNFRp75 (E92N): Fc set forth in SEQ ID NO. 11;
the amino acid sequence of TNFRp75 (E92S): Fc set forth in SEQ ID NO. 12;
the amino acid sequence of TNFRp75 (E92N, W89Y): Fc set forth in SEQ ID NO. 13;
the amino acid sequence of TNFRp75 (E92S, W89Y): Fc set forth in SEQ ID NO. 14;
the amino acid sequence of TNFRp75 (E92N, W89F): Fc set forth in SEQ ID NO. 15.
In the third aspect, the present invention discloses a DNA sequence encoding the soluble receptor or the fusion protein stated above. As well known in the art, the DNA sequences encoding the soluble receptors or the fusion proteins according to the present invention may vary according to codon degeneracy and codon bias of different host cells, but these DNA sequences still fall into the scope of the present invention, as long as the amino acid sequences encoded by these DNA sequences do not change.
In the fourth aspect, the present invention discloses use of the soluble TNFRp75 mutant or a fusion protein thereof stated above in pharmaceuticals, in particular, in the treatment of diseases associated with over-expression of TNF.alpha. and/or lymphotoxin, including but not limited to, rheumatoid arthritis, psoriasis, scleroderma, Sjogren's syndrome, ankylosing spondylitis, lupus erythematosus, dermatomyositis, and systemic lupus erythematosus-like syndrome.
In the fifth aspect, the present invention discloses a pharmaceutical composition comprising the soluble TNFRp75 mutant or a fusion protein thereof stated above.
The TNFRp75 mutants and the fusion proteins thereof in the present invention have an increased binding capacity to TNF and lymphotoxin. For example, the neutralizing activity of the soluble TNFRp75 (E92N): Fc to TNF.alpha. is 1.33 times that of the wild-type soluble TNFRp75: Fc (ENBREL from AMGEN), and the neutralizing activity to LT is 2.77 times that of the wild-type soluble TNFRp75: Fc (ENBREL from AMGEN). The TNFRp75 mutant and the fusion protein thereof in the present invention are useful in the treatment of diseases related to TNF.alpha. and LT. Because of the increased activity, the clinical dose could be reduced so as to decrease the probability of rising erythema when the drug is administered via subcutaneous injection. In addition, increase of the dissociation time in terms of TNF.alpha. binding will be advantageous for an extended action time of the drug.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1-6: Neutralization of the TNFRp75 mutant: Fc fusion protein against the cytotoxicity of TNF.alpha. or LT.sub.28-171.quadrature. Lithe wild-type TNFRp75: Fc fusion protein used as control in each experiment.
FIG. 1A: Neutralization of the TNFRp75 (E92A): Fc fusion protein against the cytotoxicity of TNF.alpha..
FIG. 1B: Neutralization of the TNFRp75 (E92A): Fc fusion protein against the cytotoxicity of LT.sub.28-171.
FIG. 2A: Neutralization of the TNFRp75 (E92H): Fc fusion protein against the cytotoxicity of TNF.alpha..
FIG. 2B: Neutralization of the TNFRp75 (E92H): Fc fusion protein against the cytotoxicity of LT.sub.28-171.
FIG. 3A: Neutralization of the TNFRp75 (E92N): Fc fusion protein against the cytotoxicity of TNF.alpha..
FIG. 3B: Neutralization of the TNFRp75 (E92N): Fc fusion protein against the cytotoxicity of LT.sub.28-171.
FIG. 4A: Neutralization of the TNFRp75 (E92N .quadrature.W89Y): Fc fusion protein against the cytotoxicity of TNF.alpha..
FIG. 4B: Neutralization of the TNFRp75 (E92N.quadrature.W89Y): Fc fusion protein against the cytotoxicity of LT.sub.28-171.
FIG. 5A: Neutralization of the TNFRp75 (E92S.quadrature.W89Y): Fc fusion protein against the cytotoxicity of TNF.alpha..
FIG. 5B: Neutralization of the TNFRp75 (E92S.quadrature.W89Y): Fc fusion protein against the cytotoxicity of LT.sub.28-171.
FIG. 6A: Neutralization of the TNFRp75 (E92N.quadrature.W89F): Fc fusion protein against the cytotoxicity of TNF.alpha..
FIG. 6B: Neutralization of the TNFRp75 (E92N.quadrature.W89F): Fc fusion protein against the cytotoxicity of LT.sub.28-171.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is now further illustrated with reference to the following examples. It should be understood that the examples are merely illustrative but in no way intended to limit the scope of the invention. Experiments in the following examples that do not indicate specific experimental conditions are performed under conventional conditions or conditions suggested by manufacters. Unless specifically indicated otherwise, the ratio and percentage are based on weight.
As used herein, the terms "TNF receptor 2", "TNFRp75" and "TNFRp75 receptor", which can be interchangeably used, include the TNFRp75 receptor derived from human as well as the homologues thereof derived from a mouse (or rat), pig, horse or bovine. Preferably, it is human TNFRp75 receptor. The amino acid sequence of the natural-occurring wild-type human TNFRp75 receptor is set forth in SEQ ID NO. 1.
"Soluble TNFp75 receptor", as used in the context of the present invention, refers to the extracellular region of a TNFp75 receptor, that is, the ligand-binding domain consisting of the N-terminal amino acid residues 1-257 of the wild-type human TNFp75 receptor, wherein the N-terminal amino acid residues 1-22 are a signal peptide.
"Soluble TNFp75 receptor" or "soluble TNFp75 receptor mutant in the present invention", as used in the context of the present invention, means a TNFp75 receptor mutant that has an increased binding ability to TNF, preferably by at least 2 times that of the wild-type, and has an increased binding ability to LT, preferably by at least 10 times. Such a mutant can be created by amino acid insertion, deletion or substitution, preferably by amino acid substitution. For example, E92H means that in the mutant His substitutes the Glu at position 92 of the wild-type sequence, numbering of the amino acid according to the wide-type sequence.
"Amino acid substitution" as used in the context of the present invention refers to the experimentally induced replacement of one or more amino acids in a polypeptide, protein, or fragment of a protein, with another one or several others by genetic engineering or artificial synthetic technology.
The TNFp75 mutant protein in the present invention can be created by synthesizing primers according to the human soluble TNFp75 receptor sequence already known in the art and then amplifying the encoding sequence of the soluble TNFp75 receptor by PCR method; alternatively, the encoding sequence of the soluble TNFp75 receptor can be synthesized artificially. Technologies for genetic modification of the encoding sequence of the soluble TNFp75 receptor, such as the point mutagenesis technology, are well known to those of skill in the art. See, for example, Mutagenesis: a Practical Approach", M. J. McPherson, Ed., (IRL press, Oxford, UK. (1991), which includes for example site-directed mutagenesis, cassette mutagenesis and mutagenic polymerase chain reaction (PCR).
Approaches for conjugation of the fragment encoding the soluble TNFp75 receptor with other fragments encoding amino acids are well known to those of skill in the art. For example, DNA sequence encoding a fusion protein can be obtained by methods such as, restriction enzyme digestion, ligation or complementary cohesive ends.
The site-directed mutant DNA sequence encoding the mutant protein according to the present invention, obtained as stated above, is then inserted into a suitable expression vector and in turn transformed into a suitable host cell. Finally, the transformed host cell is cultured and the fusion protein is obtained by separation and purification.
Expression vectors useful in the present invention can be selected from a wide range, such as commercial vectors. For example, a commercial vector is selected, and the nucleotide sequence encoding the mutant protein according to the present invention is operably linked to an expression-regulating sequence, thereby creating a protein expression vector.
"Operably linked to" as used in the context of the present invention means such a situation that some parts of a linear DNA sequence may affect the activity of the other parts of the same DNA sequence. For example, if the signal peptide DNA participates peptide secretion as a precursor, it (the leader sequence for secretion) is "operably linked to" the polypeptide-encoding DNA; if a promoter controls transcription of a DNA sequence, it is "operably linked to" the encoding sequence; and if a ribosomal binding site is at a position that allows its translation, it is "operably linked to" the encoding sequence. Generally, "operably linked to" means neighboring; however, for the leader sequence for secretion, it means neighboring in the reading frame.
"Host cells" as used in the context of the present invention include eukaryotic cells and prokaryotic cells. Prokaryotic cells commonly used include E. coli and Bacillus subtilis, etc. Eukaryotic cells commonly used include yeast cells, insect cells and mammalian cells.
In an example of the invention, the method for preparing the soluble TNFRp75: Fc fusion protein comprises the steps of:
i. Modifying the sequence encoding the wild-type soluble TNFp75 receptor to replace the amino acid at position 92 and conjugating the modified sequence with a sequence encoding the Fc fragment, thereby obtaining a gene encoding the fusion protein;
ii. cloning the gene encoding the modified soluble TNFp75 receptor: Fc fusion protein obtained above into an expression plasmid;
iii. transforming a host cell with the expression plasmid caning the gene encoding the modified soluble TNFp75 receptor: Fc fusion protein;
iv. culturing the transformed host cell;
v. collecting the host cell and the culture medium, then separating and purifying the soluble TNFp75 receptor: Fc fusion protein.
The soluble TNFp75:Fc fusion protein in the present invention is useful in the treatment of diseases associated with TNF over-expression, including but not limited to, rheumatoid arthritis, psoriasis, scleroderma, Sjogren's syndrome, ankylosing spondylitis, lupus erythematosus, dermatomyositis, systemic lupus erythematosus-like syndrome, and so on.
Said soluble TNFp75:Fc fusion protein in the present invention can be used alone or in combination with other drugs such as chemotherapy drugs.
The present invention further provides a pharmaceutical composition comprising an effective amount of one or more soluble TNFp75:Fc fusion protein of the present invention, and at least one pharmaceutically acceptable carrier, diluent or excipient. In general, the above compositions may be prepared by mixing the active ingredient and the excipient, by diluenting the active ingredient with the excipient, or by encapsulating the active ingredient in a carrier in the form of, for example, capsule or sachet. The diluent can be solid, semisolid, or liquid. The composition may be in the form of tablets, pills, powders, solutions, syrups and sterile injection solutions. Suitable examples of excipients may comprise one or more agents selected from the group consisting of lactose, glucose, sucrose, sorbitol, mannitol, starch, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, etc. Such compositions may also contain one or more agents selected from the group consisting of diluents, emulsifiers, preserving agents (such as methyl hydroxybenzoate and propyl hydroxybenzoate), and sweetening agents.
Administration routes of the soluble TNFp75:Fc fusion protein and the pharmaceutical composition according to the present invention are not specifically limited and can be in a form suitable for oral administration, for parenteral injection, or for topical administration, such as intramuscular, intravenous, or subcutaneous injection, inhalation or spray. Oral administration is preferred.
When administered orally in the form of tablets or capsules, the soluble TNFp75:Fc fusion protein will normally be administered at a unit dose within the range of 1-1000 mg for an adult having average weight of 60-70 kg, or the soluble TNFp75:Fc fusion protein may be injected parenterally at a unit dose within the range of 0.1-500 mg. It can be administered once or several times per day. A unit dose of the pharmaceutical composition generally comprises the active ingredient within the range of 1-500 mg, typically 1 mg, 5 mg, 10 mg, 25 mg, 50 mg, 100 mg, 200 mg, 300 mg, 400 mg or 500 mg.
In the treatment of specific conditions, the dose and administration regime of the active ingredient according to the present invention will depend on various factors, including the body weight, age, gender, the symptom, the severity of the illness being treated, and the particular route and frequency of administration. Accordingly the optimum dosage could be determined by the practitioner who is treating any particular patient.
The wide-type soluble human TNFp75:Fc fusion protein employed in the present invention is obtained from AMGEN under the commercial name ENBREL. The TNF.alpha. employed in the present invention is obtained from R&D Company. LT.sub.28-171 employed in the present invention is prepared according to the method disclosed in Chinese Application No. CN00111884.6.
The present invention is now illustrated with reference to examples. It should be understood that the examples are merely to illustrate the invention but not intended to limit the scope of the invention. Experiments in the following examples that do not indicate specific experimental conditions are performed under conventional conditions, for examples, those described in Sambrook, et al. Molecular cloning: a laboratory manual (New York: Cold Spring Harbor Laboratory Press, 1992), or under conditions suggested by manufacturers.
EXAMPLES
Example 1
Preparation of the TNFR75 (E92H): Fc Fusion Protein
(1) Generation of the Gene Encoding the TNFRp75 (E92H):Fc Fusion Protein
The mutant DNA sequence encoding the soluble TNF p75 receptor was obtained by SOE-PCR (Splicing by Overlapping Extension PCR) technology using the nucleotide sequence encoding the wild-type human soluble TNFRp75: Fc fusion protein as template. The first half of the DNA fragment encoding the soluble TNF p75 receptor, which comprises the mutantation site, was amplified using the encoding DNA of the wild-type soluble TNFRp75: Fc fusion protein as template and the following primers:
TABLE-US-00001 (SEQ ID NO. 16) INFRp75p.quadrature.aagcttatggctcccgtcgccgtctggg (SEQ ID NO. 17) E92HpF1.quadrature.TGCTTGAGCTGTGGCTCCCG
Then the second half of the DNA fragment encoding the soluble TNF p75 receptor, which comprises both the mutantation site and the Fc fragment, was amplified using the following primers:
TABLE-US-00002 (SEQ ID NO. 18) Fcp.quadrature.gaattcctatttacccggagacaggg (SEQ ID NO. 19) E92HpR1.quadrature.CGGGAGCCACAGCTCAAGCAgtgGGGAA
Finally the DNA fragment encoding the TNFRp75 (E92H): Fc fusion protein was PCR amplified using the two PCR products obtained above (i.e., the first half and the second half of the DNA fragment) as template and primers TNFRp75 and Fcp.
(2) Construction of Expression Vectors
After verification by sequencing, the PCR product obtained as stated above were digested with HindIII and EcoRI, then inserted into the commercial expression vector pcDNA3 (Invitrogen). The digestion and ligation were performed following the manufacturer's instructions.
(3) Transfection
The expression vector encoding the soluble TNF p75: Fc fusion protein were transformed into E. coli DH5.alpha.. The positive clones were expanded in 500 ml LB culture flask, and then DNA were extracted and purified by the Ultrapure Plasmid DNA Purification Kit (Qiagen) following the manufacturer's instructions. The plasmid DNA obtained as stated above were transfected into CHO-K1 cells (Chinese hamster ovary cells, obtained from ATCC) using the lipofectamine kit from Invitrogen following the manufacturer's instructions.
(4) Screening Clones
24-48 hours after the transfection, the culture medium was exchanged to be a screening medium containing G418(Geneticin). The screening medium was exchanged every 3 to 4 days till formation of the cell clones. When the cell clones grown into a diameter of 1 to 2 mm, monoclones were transferred into a 24-well plate. After the cells reach a confluence of 50 to 70%, supernatant in each well was tested by the ELISA assay, and the clones with high expression of the TNFRp75 mutant: Fc fusion protein were selected for screening with drug. The expression level of the TNFRp75 mutant: Fc fusion protein in each clone was measured when concentration of the drug reaches at the maximum, and two monoclonal cell strains which have high expression level and good growth were selected for seed storage.
The ELISA assay was performed as follows:
The antibody (anti-human TNFRp75-specific monoclonal antibody, R&D Company) was diluted to 1 ug/ml in the coating buffer (CBS, pH9.6), applied on a 96-well plate (100 ul/well), and allowed standing overnight at 5.quadrature.. The liquid in the well was removed and the well was washed with PBST 3 times. After drying, 400 ul/well blocking solution (1% BSA PBST) was added to the plate and incubated for 2 hrs at room temperature, and then washed with PBST 3 times and air dried. The standard sample (Amgen, commercial name ENBREL) was serially diluted in the diluting solution. The supernatant with the expressed protein was diluted to 1 ug/ml and added to duplicate wells of the 96-well plate (100 ul/well). The plate was incubated for 1 hr at 37.quadrature.. After that, the liquid in the wells was removed and the wells were washed 3 times and dried. The enzyme-linked antibody (HRP-anti-human IgG Fc-specific antibody, PIERCE) was diluted in the diluting solution to a certain concentration (1:20000), added to the 96-well plate (100 ul/well) and incubated for 1 hr at 37.quadrature.. The liquid in the wells was then removed and the wells were washed 5 times and dried. The prepared substrate mix solution was added to the 96-well plate (100 ul/well) and incubated for 10 mins at 37.quadrature.. A stop solution (50 ul/well) was added to the wells to stop the reaction. The OD value was read out at 490 nm, and content of the protein in the sample was calculated according to the standard curve.
(5) Cell Culture
1.times.10.sup.5/ml cells were amplified in a 500 ml culture flask at 37.quadrature. for 3-4 days. Passage: when cell density reaches 2.times.10.sup.5/ml, the cells were transferred into 720 cm.sup.2 roller bottles and cultured for 3-4 days. Passage: 4.times.10.sup.7 cells were transferred in to 1445 cm.sup.2 roller bottles and cultured for 6 days. Exchange of culture medium: when the cell culture reaches the platform, the culture medium was exchanged for serum free medium (SFM, Gibco Inc.). Recovery of the culture medium: 6 days after grown in SFM, the supernatant liquor was collected and purified by Protein .quadrature.A affinity chromatography to afford 8.7 mg of the TNFRp75 (E92H): Fc fusion protein.
Examples 2-7
Generation of Other TNFRp75 Mutant: Fc Fusion Proteins
The common primers for generating the nucleotide sequence encoding TNFRp75 (E92A): Fc, TNFRp75 (E92N): Fc, TNFRp75 (E92S): Fc, TNFRp75 (E92N, W89Y):Fc, TNFRp75 (E92S, W89Y): Fc and TNFRp75 (E92N, W89F): Fc are shown below:
TABLE-US-00003 TNFRp75F: aagcttatggctcccgtcgccgtctggg (SEQ ID NO. 16) Fcp: gaattcctatttacccggagacaggg (SEQ ID NO. 18)
The specific primers for generating the nucleotide sequence encoding TNFRp75 (E92A): Fc, TNFRp75 (E92N): Fc, TNFRp75 (E92S): Fc, TNFRp75 (E92Q): Fc.quadrature.TNFRp75 (E92N, W89Y): Fc, TNFRp75 (E92S, W89Y): Fc and TNFRp75 (E92N, W89F): Fc were shown in the table below:
TABLE-US-00004 Mutants Specific primers TNFRp75(E92A): Fc E92ApF1(SEQ ID NO. 20): TGCTTGAGCTGTGGCTCCCG E92ApR1(SEQ ID NO. 21): CGGGAGCCACAGCTCAAGCAggcGGGAA TNFRp75(E92N): Fc E92NpF1(SEQ ID NO. 22): TGCTTGAGCTGTGGCTCCCG E92NpR1(SEQ ID NO. 23): CGGGAGCCACAGCTCAAGCAgttGGGAA TNFRp75(E92S): Fc E92SpF1(SEQ ID NO. 24): TGCTTGAGCTGTGGCTCCCG E92SpR1(SEQ ID NO. 25): CGGGAGCCACAGCTCAAGCAgctGGGAA TNFRp75(E92N, E92NW89YpF1(SEQ ID NO. 26): W89Y): Fc GTTCCCGAGTGCTTGAG E92NW89YpR1(SEQ ID NO. 27): CGGGAGCCACAGCTCAAGCAgttGGGAA CgtaGTTCCAGAGCTGGGTGTATGT TNFRp75(E92S, E92SW89YpF1(SEQ ID NO. 28): W89Y): Fc GTTCCCGAGTGCTTGAG E92SW89YpR1(SEQ ID NO. 29): CGGGAGCCACAGCTCAAGCAgctGGGAA CgtaGTTCCAGAGCTGGGTGTATGT TNFRp75(E92N, E92NW89FpF1(SEQ ID NO. 30): W89F): Fc GTTCCCGAGTGCTTGAG E92NW89FpR1(SEQ ID NO. 31): CGGGAGCCACAGCTCAAGCAgttGGGAA CgaaGTTCCAGAGCTGGGTGTATGT
Other procedures were identical with that of Example 1.
Example 8
The Neutralizing Activity Assay of the TNFRp75 Mutant: Fc Fution Protein Against LT.sub.28-171
(1) Cell Seeding
L929 cells were seeded into a 96-well microtiter plate at a density of 1.0.times.10.sup.6 cells/well. Actinomycin D, 1 ng/ml LT.sub.28-171, and TNFRp75 (E92A):Fc of gradient concentrations were added into each cell of the experimental group, and Actinomycin D, 1 ng/ml T.sub.28-171, and the wild-type rhTNFRp75:Fc of gradient concentrations were added into each cell of the control group. The 96-well plates were incubated at 37.quadrature., 5% CO.sub.2 for 24 h.
(2) End-Point Measurement
The culture medium was completely removed from the 96-well plates. The dying solution of 40 ul was added into each well. After 10 minutes, the dying solution was removed and the plate was washed with water 3 times till the used water was colorless.
The residual water was allowed to be dried as far as possible. The decoloring solution of 100 ul/well was added into each well of the 96-well plates and mixed thoroughly. The plates were read out by an enzyme-labelled meter at 570 nm.
(3) Result Analysis:
The results were automatically analyzed by the Four Parameter Equation in the PraphPad Prism4.0 data-processing software: the x-axis is logarithm of the concentration of the standard sample, and the y-axis is the OD.sub.570 value. The concentration for 50% of the maximum effect (EC50) was also provided by the software, which was 7.93 ng/ml for the neutralizing activity of TNFRp75 (E92A): Fc on LT, and 22.31 ng/ml for the neutralizing activity of the wild-type rhTNFRp75:Fc on LT. The neutralizing activity of the mutant against LT was increased by 291%. An "S" curve plotted according to the experimental results was shown in FIG. 1.
The neutralizing activity assay of other TNFRp75: Fc mutants against the cytotoxicity of LT.sub.28-171 was carried out in the same manner. The results were shown in the table below. An "S" curve plotted according to the experimental results was shown in FIG. 2-6.
TABLE-US-00005 EC50(ng/ml) of the neutralizing activity of the wild-type TNFRp75: Fc against Enhancement of LT/EC50(ng/ml) of the the neutralizing neutralizing activity of activity against Mutants the mutants against LT LT (.quadrature.) TNFRp75(E92A): Fc 23.11/7.93 291% TNFRp75(E92H): Fc 44.05/3.74 1177% TNFRp75(E92N): Fc 21.99/7.94 277% TNFRp75(E92N, 54.49/3.74 1457% W89Y): Fc TNFRp75(E92S, 23.11/6.28 368% W89Y): Fc TNFRp75(E92N, 23.28/7.56 308% W89F): Fc
Example 9
The Neutralizing Activity Assay of the TNFRp75: Fc Mutant Against the Cytotoxicity of TNF.alpha.
L929 cells were seeded into a 96-well microtiter plate at a density of 1.0.times.10.sup.6 cells/well. Actinomycin D, 10 ng/ml TNF.alpha., and TNFRp75:Fc or the mutants thereof in gradient concentrations were added into each cell of the plate. The 96-well plate was incubated at 37.quadrature., 5% CO.sub.2 for 24 h.
Other procedures and data-processing are performed as those described for Example 8.
The results were shown in the table below. X-axis in the figure is logarithm of concentration (ng/ml) of the fusion protein, and the y-axis is the light absorption at 570 nm.
TABLE-US-00006 EC50(ng/ml) of the neutralizing activity of the wild-type TNFRp75: Fc against Enhancement of LT/EC50(ng/ml) of the the neutralizing neutralizing activity of activity against Mutants the mutants against LT TNF.alpha. (.quadrature.) TNFRp75(E92A): Fc 8.25/6.34 130% TNFRp75(E92H): Fc 11.63/9.03 129% TNFRp75(E92N): Fc 7.43/5.68 131% TNFRp75(E92N, 7.52/5.04 149% W89Y): Fc TNFRp75(E92S, 16.29/12.22 133% W89Y): Fc TNFRp75(E92N, 13.06/1020 128% W89F): Fc
An "S" curve was plotted according to the experimental results using the GraphPad Prism4.0 software, as shown in FIG. 1-6.
Example 10
Measurement of the Binding Constant of TNFRp75 (E92N.quadrature.W89Y):Fc for TNF.alpha. and LT
(1) Materials and Instruments:
A. The ligands TNF-.alpha. and LT, the receptors rhTNFRp75: Fc, and TNFRp75 (E92N, W89Y):Fc 3.8 mg/mL
B. HBS-P buffer (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.005% (v/v) surfactant P20, pH 7.4).
C. The activating agent N-ethyl-N'-dimethylaminopropyl carbodiimide (EDC), N-hydroxysuccinimide (NHS), ethanolamine, etc., all purchased from Sigma company.
D. Instruments for measuring interaction between biological macromolecules: BIAcore3000, carboxymethylcellulose sensor chip (CM5) (G.E. Inc.) purchased from GE company.
(2) Methods
A. Conjugation of rhTNFRp75: Fc
The rhTNFRp75: Fc was conjugated to the FC2 channel of the CM5 chip using the amino conjugation method provided in the software Wizard of Biacore3000. HBS-P was used as a running buffer, and 1 mg/mL of rhTNFRp75: Fc was diluted to a final concentration of 100 .mu.g/mL in a NaAC solution (10 mM, pH4.0). EDC (0.2M) and NHS (50 mM) were mixed in a ratio of 1:1, and then applied onto the surface of the chip at a flow rate of 10 .mu.L/min for 7 mins. Thereafter, solution of the receptor was applied and then ethanolamine (1M, pH8.5) was applied to block the activated surface of the chip. The final conjugation amount of the TNFRp75 was 7043.6 RU.
B. Conjugation of TNFRp75 (E92N, W89Y): Fc
The TNFRp75 (E92N, W89Y): Fc was conjugated to the FC4 channel of the CM5 chip using the amino conjugation method provided in the software Wizard of Biacore3000. HBS-P was used as a running buffer, and 3.8 mg/mL of TNFRp75 (E92N, W89Y): Fc was diluted to a final concentration of 100 .mu.g/mL in a NaAC solution (10 mM, pH4.0). EDC (0.2M) and NHS (50 mM) were mixed in a ratio of 1:1, and then applied onto the chip surface at a flow rate of 10 .mu.L/min for 7 mins. Thereafter, solution of the receptor was applied and then ethanolamine (1M, pH8.5) was applied to block the activated surface of the chip. The final conjugation amount of the TNFRp75 (E92N, W89Y): Fc was 6275.0 RU.
C. Primary Screening and Kinetics Assay of rhTNFRp75: Fc
The binding activity of the receptor TNFRp75: Fc to TNF or LT was measured by SPR (surface plasma resonance). The ligands were diluted in the HBS-P buffer to a concentration of 1 nm or 10 nm, respectively, and then centrifuged and injected automatically to measure the binding activity of the receptor TNFRp75 to ligands of various concentrations. Ligands showing binding activity were subjected to kinetics assay.
The stock solution of TNF.alpha. in a concentration of 10 .mu.g/L (575 nM) was serially diluted into 0, 0.3125, 0.625, 1.25, 2.5, 5.0, 10.0, and 20.0 nM in the HBS-P buffer.
The stock solution of LT in a concentration of 2.25 mg/mL (137 .mu.M) was serially diluted into 0, 0.3125, 0.625, 1.25, 2.5, 5.0, 10.0, and 20.0 nM in the HBS-P buffer.
The interaction of the receptor and the ligand was measured in kinetics assay using Wizard of Biacore3000. All the ligands were applied at a flow rate of 40 .mu.L/min for 1 min, dissociated for 2 min, and then 50 mM NaOH and HBS-P buffer were applied at a flow rate of 100 pL/min for 15 s and 60 s to regenerate the ligands (50 mM NaOH and HBS-P buffer were applied at a flow rate of 100 .mu.L/min for 10 s and 30 s to regenerate in the primary screening). The experimental data were fit to the 1:1 Langmuir association model in the analysis software of Biacore3000 to provide the specific kinetic constant.
D. Primary Screening and Kinetics Assay of TNFRp75(E92N, W89Y): Fc
The binding activity of the receptor TNFRp75(E92N, W89Y): Fc to TNF or LT was measured by SPR (surface plasma resonance). The ligands were diluted in the HBS-P buffer to a concentration of 1 nm or 10 nm, respectively, and then centrifuged and injected automatically to measure the binding activity of the receptor TNFRp75(E92N, W89Y): Fc to ligands of various concentrations. Ligands showing binding activity were subjected to kinetics assay.
The stock solution of TNF.alpha. in a concentration of 10 .mu.g/mL (575 nM) was serially diluted into 0, 0.3125, 0.625, 1.25, 2.5, 5.0, 10.0, and 20.0 nM in the HBS-P buffer.
The stock solution of LT in a concentration of 2.25 mg/mL (137 .mu.M) was serially diluted into 0, 0.3125, 0.625, L25, 2.5, 5.0, 10.0, and 20.0 nM in the HBS-P buffer.
The interaction of the receptor and the ligand was measured in kinetics assay using Wizard of Biacore3000. All the ligands were applied at a flow rate of 40 .mu.L/min for 1 min, dissociated for 2 min, and then 50 mM NaOH and HBS-P buffer were applied at a flow rate of 100 .mu.L/min for 15 s and 60 s to regenerate the ligands (50 mM NaOH and HBS-P buffer were applied at a flow rate of 100 .mu.L/min for 10 s and 30 s to regenerate in the primary screening). The experimental data were fit to the 1:1 Langmuir association model in the analysis software of Biacore3000 to provide the specific kinetic constant.
(3) Results:
A. The binding kinetics data of rhTNFRp75: Fc for TNF.alpha. (abbreviated as TNF) and LT were shown below.
TABLE-US-00007 Ligands K.sub.a(1/Ms) K.sub.d(1/s) K.sub.D(nM) Chi.sup.2 TNF 8.45 .times. 10.sup.3 4.1 .times. 10.sup.-6 4.85 .times. 10.sup.-10 107 LT 5.23 .times. 10.sup.3 6.99 .times. 10.sup.-7 1.34 .times. 10.sup.-10 8.86
B. The binding kinetics data of TNFRp75 (E92N, W89Y):Fc for TNF.alpha. (abbreviated as TNF) and LT were shown below.
TABLE-US-00008 Ligands K.sub.a(1/Ms) K.sub.d(1/s) K.sub.D(nM) Chi.sup.2 TNF 9.72 .times. 10.sup.3 1.29 .times. 10.sup.-6 1.33 .times. 10.sup.-10 26.6 LT 1.88 .times. 10.sup.4 1.64 .times. 10.sup.-6 8.74 .times. 10.sup.-11 2.04
Compared with TNFRp75: Fc, the equilibrium dissociation constant (KD) of TNFRp75 (E92N, W89Y) for TNF.alpha. or LT showed a 2- to 3-fold decrease, indicating that the binding affinity of TNFRp75 (E92N, W89Y) to TNF.alpha. or LT was enhanced. In addition, the dissociation constant (k.sub.d) of TNFRp75 (E92N, W89Y) for TNF.alpha. was remarkably lower than that of TNFRp75: Fc, indicating that the complex of TNFRp75 (E92N, W89Y) and TNF.alpha. is more stable in vitro, which may improve the half-life of TNFRp75 (E92N, W89Y) in vivo.
The specific embodiment described above are merely to illustrate the invention but not intended to restrict the scope of the invention. The present invention will also encompass the functionally equivalent methods and components. In light of the description herein as well as the accompanying drawings, those of skill in the art can readily make various changes and modifications, which will also fall into the scope of the invention.
SEQUENCE LISTINGS
1
311257PRTHomo sapiens 1Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Glu Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp2257PRTHomo sapiensMutant(92)..(92) 2Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro His Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp3257PRTHomo sapiensMutant(92)..(92) 3Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Ala Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp 4257PRTHomo sapiensMutant(92)..(92) 4Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Asn Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp5257PRTHomo sapiensMutant(92)..(92) 5Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Ser Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp6257PRTHomo sapiensMutant(89)..(89)Mutant(92)..(92) 6Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Tyr Val Pro Asn Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp7257PRTHomo sapiensMutant(89)..(89)Mutant(92)..(92) 7Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Tyr Val Pro Ser Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp8257PRTHomo sapiensMutant(89)..(89)Mutant(92)..(92) 8Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Phe Val Pro Asn Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp9489PRTArtificial SequenceFusion protein of the TNFRp75 mutant and the Fc fragment 9Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro His Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 260 265 270Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 275 280 285Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 290 295 300Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr305 310 315 320Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 325 330 335Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 340 345 350Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys
Lys Val Ser Asn Lys 355 360 365Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 370 375 380Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu385 390 395 400Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 405 410 415Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 420 425 430Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 435 440 445Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 450 455 460Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln465 470 475 480Lys Ser Leu Ser Leu Ser Pro Gly Lys 48510489PRTArtificial SequenceFusion protein of the TNFRp75 mutant and the Fc fragment 10Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Ala Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 260 265 270Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 275 280 285Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 290 295 300Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr305 310 315 320Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 325 330 335Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 340 345 350Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 355 360 365Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 370 375 380Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu385 390 395 400Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 405 410 415Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 420 425 430Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 435 440 445Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 450 455 460Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln465 470 475 480Lys Ser Leu Ser Leu Ser Pro Gly Lys 48511489PRTArtificial SequenceFusion protein of the TNFRp75 mutant and the Fc fragment 11Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Asn Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 260 265 270Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 275 280 285Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 290 295 300Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr305 310 315 320Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 325 330 335Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 340 345 350Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 355 360 365Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 370 375 380Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu385 390 395 400Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 405 410 415Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 420 425 430Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 435 440 445Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 450 455 460Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln465 470 475 480Lys Ser Leu Ser Leu Ser Pro Gly Lys 48512489PRTArtificial SequenceFusion protein of the TNFRp75 mutant and the Fc fragment 12Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Ser Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 260 265 270Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 275 280 285Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 290 295 300Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr305 310 315 320Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 325 330 335Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 340 345 350Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 355 360 365Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 370 375 380Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu385 390 395 400Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 405 410 415Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 420 425 430Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 435 440 445Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 450 455 460Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln465 470 475 480Lys Ser Leu Ser Leu Ser Pro Gly Lys 48513489PRTArtificial Sequenceprotein of the TNFRp75 mutant and the Fc fragment 13Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Tyr Val Pro Asn Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 260 265 270Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 275 280 285Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 290 295 300Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr305 310 315 320Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 325 330 335Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 340 345 350Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 355 360 365Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 370 375 380Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu385 390 395 400Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 405 410 415Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 420 425 430Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 435 440 445Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 450 455 460Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln465 470 475 480Lys Ser Leu Ser Leu Ser Pro Gly Lys 48514489PRTArtificial SequenceFusion protein of the TNFRp75 mutant and the Fc fragment 14Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Tyr Val Pro Ser Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 260 265 270Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 275 280 285Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 290 295 300Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr305 310 315 320Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys
Pro Arg Glu Glu 325 330 335Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 340 345 350Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 355 360 365Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 370 375 380Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu385 390 395 400Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 405 410 415Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 420 425 430Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 435 440 445Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 450 455 460Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln465 470 475 480Lys Ser Leu Ser Leu Ser Pro Gly Lys 48515489PRTArtificial SequenceFusion protein of the TNFRp75 mutant and the Fc fragment 15Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5 10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr 20 25 30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln 35 40 45Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys 50 55 60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65 70 75 80Ser Thr Tyr Thr Gln Leu Trp Asn Phe Val Pro Asn Cys Leu Ser Cys 85 90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg 100 105 110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu 115 120 125Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135 140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val145 150 155 160Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr 165 170 175Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly 180 185 190Asn Ala Ser Met Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser 195 200 205Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210 215 220Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser225 230 235 240Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly 245 250 255Asp Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro 260 265 270Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys 275 280 285Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val 290 295 300Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr305 310 315 320Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu 325 330 335Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His 340 345 350Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys 355 360 365Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln 370 375 380Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu385 390 395 400Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro 405 410 415Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn 420 425 430Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu 435 440 445Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val 450 455 460Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln465 470 475 480Lys Ser Leu Ser Leu Ser Pro Gly Lys 4851628DNAArtificial SequenceDNA primer 16aagcttatgg ctcccgtcgc cgtctggg 281720DNAArtificial SequenceDNA primer 17tgcttgagct gtggctcccg 201826DNAArtificial SequenceDNA primer 18gaattcctat ttacccggag acaggg 261928DNAArtificial SequenceDNA primer 19cgggagccac agctcaagca gtggggaa 282020DNAArtificial SequenceDNA primer 20tgcttgagct gtggctcccg 202128DNAArtificial SequenceDNA primer 21cgggagccac agctcaagca ggcgggaa 282220DNAArtificial SequenceDNA primer 22tgcttgagct gtggctcccg 202328DNAArtificial SequenceDNA primer 23cgggagccac agctcaagca gttgggaa 282420DNAArtificial SequenceDNA primer 24tgcttgagct gtggctcccg 202528DNAArtificial SequenceDNA Primer 25cgggagccac agctcaagca gctgggaa 282617DNAArtificial SequenceDNA primer 26gttcccgagt gcttgag 172753DNAArtificial SequenceDNA primer 27cgggagccac agctcaagca gttgggaacg tagttccaga gctgggtgta tgt 532817DNAArtificial SequenceDNA primer 28gttcccgagt gcttgag 172953DNAArtificial SequenceDNA primer 29cgggagccac agctcaagca gctgggaacg tagttccaga gctgggtgta tgt 533017DNAArtificial SequenceDNA primer 30gttcccgagt gcttgag 173153DNAArtificial SequenceDNA primer 31cgggagccac agctcaagca gttgggaacg aagttccaga gctgggtgta tgt 53